Incidental Mutation 'R6693:Pdpk1'
List |< first << previous [record 25 of 36] next >> last >|
ID528185
Institutional Source Beutler Lab
Gene Symbol Pdpk1
Ensembl Gene ENSMUSG00000024122
Gene Name3-phosphoinositide dependent protein kinase 1
SynonymsPkb kinase, Pdk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24073680-24150924 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 24111126 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052462] [ENSMUST00000052462] [ENSMUST00000052462] [ENSMUST00000052462] [ENSMUST00000102927] [ENSMUST00000102927] [ENSMUST00000102927] [ENSMUST00000102927] [ENSMUST00000115407] [ENSMUST00000115407] [ENSMUST00000115407] [ENSMUST00000115407] [ENSMUST00000115409] [ENSMUST00000115409] [ENSMUST00000115409] [ENSMUST00000115409] [ENSMUST00000115411] [ENSMUST00000115411] [ENSMUST00000115411] [ENSMUST00000115411] [ENSMUST00000128997] [ENSMUST00000128997] [ENSMUST00000128997] [ENSMUST00000128997] [ENSMUST00000144533] [ENSMUST00000144533] [ENSMUST00000144533] [ENSMUST00000144533] [ENSMUST00000154982] [ENSMUST00000154982] [ENSMUST00000154982] [ENSMUST00000154982]
Predicted Effect probably null
Transcript: ENSMUST00000052462
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052462
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052462
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052462
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102927
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102927
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102927
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102927
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115407
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115407
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115407
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115407
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115411
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115411
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115411
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115411
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140906
Predicted Effect probably null
Transcript: ENSMUST00000144533
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144533
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144533
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144533
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150578
Predicted Effect probably null
Transcript: ENSMUST00000154982
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154982
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154982
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154982
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit embryogenesis defects, impaired forebrain development, and die by mid gestation. Cardiac muscle-specific conditional mutants exhibit thin ventricular walls and die of heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Pdpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdpk1 APN 17 24106861 missense possibly damaging 0.87
IGL01467:Pdpk1 APN 17 24088170 missense probably damaging 0.98
IGL02251:Pdpk1 APN 17 24079638 missense probably damaging 1.00
IGL03411:Pdpk1 APN 17 24101644 missense probably damaging 1.00
R0152:Pdpk1 UTSW 17 24106946 missense possibly damaging 0.93
R0610:Pdpk1 UTSW 17 24098171 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1817:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1819:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1822:Pdpk1 UTSW 17 24098176 splice site probably benign
R1823:Pdpk1 UTSW 17 24098176 splice site probably benign
R3783:Pdpk1 UTSW 17 24110850 missense possibly damaging 0.95
R4653:Pdpk1 UTSW 17 24106897 missense probably benign 0.25
R5000:Pdpk1 UTSW 17 24111045 missense possibly damaging 0.66
R5385:Pdpk1 UTSW 17 24098140 nonsense probably null
R5425:Pdpk1 UTSW 17 24098121 missense probably damaging 1.00
R5429:Pdpk1 UTSW 17 24091560 missense probably benign 0.01
R5642:Pdpk1 UTSW 17 24106855 nonsense probably null
R5936:Pdpk1 UTSW 17 24093229 missense probably damaging 1.00
R6049:Pdpk1 UTSW 17 24098135 nonsense probably null
R6332:Pdpk1 UTSW 17 24106922 missense probably damaging 0.99
R7423:Pdpk1 UTSW 17 24110900 missense probably benign 0.08
R7432:Pdpk1 UTSW 17 24101669 missense probably benign 0.43
R8279:Pdpk1 UTSW 17 24088173 missense probably benign
R8698:Pdpk1 UTSW 17 24079568 missense probably damaging 1.00
R8827:Pdpk1 UTSW 17 24088217 missense probably benign 0.02
RF016:Pdpk1 UTSW 17 24093281 missense probably benign 0.01
Z1177:Pdpk1 UTSW 17 24088013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCTCGCCAAGAATTTTCC -3'
(R):5'- TCTTGCCAGCATTGGGTGTC -3'

Sequencing Primer
(F):5'- TCCCAAACTTGAAGTCTTCAGGG -3'
(R):5'- CCAGCATTGGGTGTCTCTGTATAAAG -3'
Posted On2018-07-24