Incidental Mutation 'R6693:Lmf1'
List |< first << previous [record 16 of 36] next >> last >|
ID528186
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25645278 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 287 (M287L)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect probably benign
Transcript: ENSMUST00000063344
AA Change: M287L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: M287L

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116641
AA Change: M287L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: M287L

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127280
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect unknown
Transcript: ENSMUST00000154842
AA Change: M283L
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279
AA Change: M283L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4636:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
R8851:Lmf1 UTSW 17 25585706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAAGGCTGGTAATTCAAAG -3'
(R):5'- CAAGGTCTGTGTTGCTGCTC -3'

Sequencing Primer
(F):5'- GCTGGTAATTCAAAGCCCACTTTTG -3'
(R):5'- TCCAGACTGGATGGGACAC -3'
Posted On2018-07-24