Incidental Mutation 'R6693:Tgif1'
List |< first << previous [record 34 of 36] next >> last >|
ID528187
Institutional Source Beutler Lab
Gene Symbol Tgif1
Ensembl Gene ENSMUSG00000047407
Gene NameTGFB-induced factor homeobox 1
SynonymsTgif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6693 (G1)
Quality Score216.009
Status Validated
Chromosome17
Chromosomal Location70844205-70853546 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 70850890 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059775] [ENSMUST00000118283] [ENSMUST00000127719] [ENSMUST00000134654] [ENSMUST00000135007] [ENSMUST00000166395] [ENSMUST00000172229] [ENSMUST00000186358]
Predicted Effect probably benign
Transcript: ENSMUST00000059775
SMART Domains Protein: ENSMUSP00000060512
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 35 100 1.53e-13 SMART
low complexity region 117 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118283
SMART Domains Protein: ENSMUSP00000113192
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125329
Predicted Effect probably benign
Transcript: ENSMUST00000127719
SMART Domains Protein: ENSMUSP00000115375
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132825
Predicted Effect probably benign
Transcript: ENSMUST00000134654
SMART Domains Protein: ENSMUSP00000125247
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:Homeobox_KN 33 58 7.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135007
SMART Domains Protein: ENSMUSP00000124168
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156484
SMART Domains Protein: ENSMUSP00000124970
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 6 57 2.23e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166395
SMART Domains Protein: ENSMUSP00000130930
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 68 133 1.53e-13 SMART
low complexity region 150 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172229
SMART Domains Protein: ENSMUSP00000127139
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 15 80 1.53e-13 SMART
low complexity region 97 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176549
Predicted Effect probably benign
Transcript: ENSMUST00000186358
SMART Domains Protein: ENSMUSP00000139438
Gene: ENSMUSG00000047407

DomainStartEndE-ValueType
HOX 35 84 1.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190687
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display normal growth, behavior and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Tgif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Tgif1 APN 17 70846240 missense probably damaging 1.00
IGL03169:Tgif1 APN 17 70844841 missense possibly damaging 0.93
IGL03179:Tgif1 APN 17 70844947 missense possibly damaging 0.80
R0050:Tgif1 UTSW 17 70850884 missense probably damaging 1.00
R4569:Tgif1 UTSW 17 70844917 missense possibly damaging 0.51
R4877:Tgif1 UTSW 17 70849705 splice site probably null
R4914:Tgif1 UTSW 17 70845247 missense probably damaging 1.00
R4985:Tgif1 UTSW 17 70844872 missense probably benign 0.02
R5272:Tgif1 UTSW 17 70846254 missense probably damaging 1.00
R5760:Tgif1 UTSW 17 70845001 missense probably damaging 1.00
R6270:Tgif1 UTSW 17 70844866 splice site probably null
R6528:Tgif1 UTSW 17 70846560 intron probably benign
R7231:Tgif1 UTSW 17 70846173 missense probably damaging 1.00
R7319:Tgif1 UTSW 17 70844852 missense probably damaging 0.99
R7776:Tgif1 UTSW 17 70851457 unclassified probably benign
R7818:Tgif1 UTSW 17 70849608 splice site probably null
R8100:Tgif1 UTSW 17 70846549 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTCGGGTTGTGTCTAGAAG -3'
(R):5'- GTCACTTGAATTCCAACCCAG -3'

Sequencing Primer
(F):5'- TTGTGTCTAGAAGGAAAAGAACACC -3'
(R):5'- AGAAGCCAGCGCCTGAGAC -3'
Posted On2018-07-24