Incidental Mutation 'R6693:Pcdhb15'
ID528188
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Nameprotocadherin beta 15
SynonymsPcdhbO, Pcdhb7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37473540-37476340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37474341 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 209 (T209S)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
AA Change: T209S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: T209S

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Slc25a45 T C 19: 5,880,134 V44A possibly damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37475154 missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37474993 missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37474261 missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37474038 missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37475502 missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37473957 missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37475220 missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37473850 missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37475671 missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37475276 missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37475398 missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37474168 missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37475895 missense probably benign
R0554:Pcdhb15 UTSW 18 37474519 missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37475566 missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37474621 missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37473762 missense probably benign 0.01
R1423:Pcdhb15 UTSW 18 37473922 missense probably damaging 0.97
R1672:Pcdhb15 UTSW 18 37474660 missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37473813 missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37476031 missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37475443 missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37475389 missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37474389 missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37473757 missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37475890 missense probably benign 0.00
R4432:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4433:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37475575 missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37475595 missense probably damaging 0.96
R4988:Pcdhb15 UTSW 18 37475802 missense probably damaging 0.98
R5635:Pcdhb15 UTSW 18 37473770 nonsense probably null
R5692:Pcdhb15 UTSW 18 37474449 missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37474767 missense probably damaging 0.99
R5913:Pcdhb15 UTSW 18 37474654 missense probably benign 0.07
R6350:Pcdhb15 UTSW 18 37475361 missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37474261 missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37474807 missense possibly damaging 0.60
R6905:Pcdhb15 UTSW 18 37474695 missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37475568 missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37474336 missense probably damaging 1.00
R7529:Pcdhb15 UTSW 18 37474473 nonsense probably null
R7718:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R7782:Pcdhb15 UTSW 18 37474735 missense possibly damaging 0.88
R7967:Pcdhb15 UTSW 18 37474849 missense probably damaging 1.00
R8170:Pcdhb15 UTSW 18 37475584 missense probably damaging 1.00
R8323:Pcdhb15 UTSW 18 37475662 missense probably benign 0.18
R8725:Pcdhb15 UTSW 18 37475681 missense probably damaging 0.99
R8820:Pcdhb15 UTSW 18 37473918 missense probably benign 0.03
X0062:Pcdhb15 UTSW 18 37476015 nonsense probably null
X0063:Pcdhb15 UTSW 18 37475084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAAGTACCACTCCAGGGG -3'
(R):5'- TTGTCCGTAACTTCCTGTGTCTAAG -3'

Sequencing Primer
(F):5'- GCGACGCTTCTCTTGGAAAG -3'
(R):5'- TGTGTCTAAGTCCCTGGCAGAC -3'
Posted On2018-07-24