Incidental Mutation 'R6693:Slc25a45'
ID528189
Institutional Source Beutler Lab
Gene Symbol Slc25a45
Ensembl Gene ENSMUSG00000024818
Gene Namesolute carrier family 25, member 45
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6693 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5877808-5885766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5880134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 44 (V44A)
Ref Sequence ENSEMBL: ENSMUSP00000121596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025728] [ENSMUST00000025732] [ENSMUST00000125114] [ENSMUST00000136833] [ENSMUST00000145200] [ENSMUST00000155227] [ENSMUST00000155697]
Predicted Effect probably benign
Transcript: ENSMUST00000025728
SMART Domains Protein: ENSMUSP00000025728
Gene: ENSMUSG00000024816

DomainStartEndE-ValueType
B41 26 273 9.58e-4 SMART
low complexity region 383 398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000025732
AA Change: V44A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025732
Gene: ENSMUSG00000024818
AA Change: V44A

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 1.2e-20 PFAM
Pfam:Mito_carr 95 195 6.9e-22 PFAM
Pfam:Mito_carr 197 288 7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125114
AA Change: V44A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122076
Gene: ENSMUSG00000024818
AA Change: V44A

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 4.7e-22 PFAM
Pfam:Mito_carr 95 195 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136833
AA Change: V44A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121602
Gene: ENSMUSG00000024818
AA Change: V44A

DomainStartEndE-ValueType
Pfam:Mito_carr 1 102 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141362
AA Change: V43A

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114648
Gene: ENSMUSG00000024818
AA Change: V43A

DomainStartEndE-ValueType
Pfam:Mito_carr 1 70 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145200
SMART Domains Protein: ENSMUSP00000117220
Gene: ENSMUSG00000024818

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Mito_carr 37 137 5.1e-23 PFAM
Pfam:Mito_carr 139 195 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155227
SMART Domains Protein: ENSMUSP00000116453
Gene: ENSMUSG00000024816

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Pfam:FERM_M 136 202 9.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155697
AA Change: V44A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121596
Gene: ENSMUSG00000024818
AA Change: V44A

DomainStartEndE-ValueType
Pfam:Mito_carr 1 87 8.9e-22 PFAM
Pfam:Mito_carr 95 195 6.8e-23 PFAM
Pfam:Mito_carr 197 288 2.4e-23 PFAM
Meta Mutation Damage Score 0.3570 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,154 V1368A probably benign Het
Aak1 C T 6: 86,965,515 S680L unknown Het
Adam25 A T 8: 40,754,531 N278I probably damaging Het
Adamtsl1 C A 4: 86,342,886 H1111Q probably benign Het
Adgrg7 T A 16: 56,770,224 N195Y probably damaging Het
Arhgap23 A G 11: 97,466,517 N436S probably damaging Het
Cfap65 T C 1: 74,917,286 I1045V probably benign Het
Chrm3 T C 13: 9,877,422 N526S probably benign Het
Cpeb2 A T 5: 43,285,912 D982V probably damaging Het
Fbxw27 T C 9: 109,788,044 I130V probably benign Het
Glb1l T C 1: 75,209,101 D61G probably damaging Het
Herc1 G A 9: 66,478,976 C3737Y probably damaging Het
Kcnt2 A T 1: 140,351,227 M39L probably benign Het
Kif17 C A 4: 138,286,480 Q236K probably benign Het
Klhl25 T C 7: 75,866,813 V184A possibly damaging Het
Lmf1 A T 17: 25,645,278 M287L probably benign Het
Macf1 T C 4: 123,473,808 T822A possibly damaging Het
Mmp13 A T 9: 7,280,245 T392S probably benign Het
Myo6 T A 9: 80,245,731 N215K probably damaging Het
Nedd1 T C 10: 92,698,337 K317R possibly damaging Het
Olfr1154 A G 2: 87,903,308 Y123H probably damaging Het
Olfr146 C T 9: 39,018,801 A247T probably damaging Het
Pax9 T A 12: 56,709,731 S285T probably benign Het
Pcdhb15 A T 18: 37,474,341 T209S probably benign Het
Pdpk1 A T 17: 24,111,126 probably null Het
Rbak T C 5: 143,174,111 K396E probably damaging Het
Rps6ka5 A G 12: 100,573,829 V545A probably benign Het
Scg2 G T 1: 79,436,020 Q329K probably benign Het
Shroom3 G A 5: 92,940,758 A456T possibly damaging Het
Slc12a7 G T 13: 73,797,537 A489S probably benign Het
Slc16a4 T C 3: 107,303,064 I350T probably damaging Het
Sucla2 T A 14: 73,568,667 L102* probably null Het
Tgif1 T A 17: 70,850,890 probably benign Het
Tmem8b A G 4: 43,669,837 E111G probably benign Het
Zfp971 G T 2: 178,033,431 K274N probably benign Het
Other mutations in Slc25a45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Slc25a45 APN 19 5884609 splice site probably null
IGL02620:Slc25a45 APN 19 5884526 missense probably damaging 1.00
IGL02622:Slc25a45 APN 19 5878697 splice site probably benign
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0055:Slc25a45 UTSW 19 5880467 missense probably damaging 1.00
R0630:Slc25a45 UTSW 19 5880528 missense probably damaging 1.00
R1464:Slc25a45 UTSW 19 5879900 splice site probably benign
R1764:Slc25a45 UTSW 19 5884930 missense probably damaging 1.00
R1902:Slc25a45 UTSW 19 5884522 missense probably damaging 1.00
R2372:Slc25a45 UTSW 19 5884552 missense probably benign 0.00
R3547:Slc25a45 UTSW 19 5884546 missense probably damaging 1.00
R3889:Slc25a45 UTSW 19 5880633 splice site probably benign
R4173:Slc25a45 UTSW 19 5880583 nonsense probably null
R4222:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4223:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4225:Slc25a45 UTSW 19 5880118 missense probably damaging 1.00
R4598:Slc25a45 UTSW 19 5884436 missense probably damaging 1.00
R4998:Slc25a45 UTSW 19 5884917 missense probably damaging 1.00
R5063:Slc25a45 UTSW 19 5884462 missense possibly damaging 0.89
R5711:Slc25a45 UTSW 19 5884423 missense probably benign
R7486:Slc25a45 UTSW 19 5884969 missense probably damaging 0.96
R8437:Slc25a45 UTSW 19 5880107 missense probably benign 0.06
Z1177:Slc25a45 UTSW 19 5880179 missense unknown
Z1177:Slc25a45 UTSW 19 5884432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAGTGTAGCAAAGGCACC -3'
(R):5'- ACCCCGTCACCACTTTTGAG -3'

Sequencing Primer
(F):5'- ATAGATGGTCTGGCTGGAACC -3'
(R):5'- CACTTTTGAGGCACTAGAGGACTC -3'
Posted On2018-07-24