Incidental Mutation 'R6700:Olfr427'
ID528194
Institutional Source Beutler Lab
Gene Symbol Olfr427
Ensembl Gene ENSMUSG00000059371
Gene Nameolfactory receptor 427
SynonymsMOR105-7, MOR105-9, GA_x6K02T2P20D-21075927-21074980
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6700 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174096891-174103224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174099839 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000149570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080831] [ENSMUST00000213832]
Predicted Effect probably damaging
Transcript: ENSMUST00000080831
AA Change: C127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079644
Gene: ENSMUSG00000059371
AA Change: C127Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-58 PFAM
Pfam:7tm_1 41 289 3.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201135
Predicted Effect probably damaging
Transcript: ENSMUST00000213832
AA Change: C127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Olfr427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Olfr427 APN 1 174100367 missense probably benign
IGL01804:Olfr427 APN 1 174099835 missense probably damaging 1.00
IGL02573:Olfr427 APN 1 174100130 missense possibly damaging 0.94
IGL02736:Olfr427 APN 1 174099647 missense probably damaging 0.99
R0012:Olfr427 UTSW 1 174100207 missense probably damaging 1.00
R0437:Olfr427 UTSW 1 174100399 missense probably benign 0.04
R0688:Olfr427 UTSW 1 174100064 missense probably damaging 1.00
R1473:Olfr427 UTSW 1 174099749 missense probably damaging 1.00
R1754:Olfr427 UTSW 1 174100033 missense probably benign 0.24
R5453:Olfr427 UTSW 1 174099467 missense probably benign
R5776:Olfr427 UTSW 1 174099773 missense probably damaging 1.00
R7472:Olfr427 UTSW 1 174099733 missense probably damaging 1.00
R7683:Olfr427 UTSW 1 174099476 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATGTCCGTCTGCACAATC -3'
(R):5'- GCACAGGTTCTAAGTCACAGAAG -3'

Sequencing Primer
(F):5'- AATCCCATGTACAGTTTCATCAGC -3'
(R):5'- CAGAAGAGCTGGTGAATCTGATTG -3'
Posted On2018-07-24