Incidental Mutation 'R6700:Strbp'
ID528195
Institutional Source Beutler Lab
Gene Symbol Strbp
Ensembl Gene ENSMUSG00000026915
Gene Namespermatid perinuclear RNA binding protein
Synonyms6430510M02Rik, Spnr, C230082I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R6700 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37483228-37703859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37603963 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 366 (D366G)
Ref Sequence ENSEMBL: ENSMUSP00000072047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028279] [ENSMUST00000072186] [ENSMUST00000183690]
Predicted Effect probably null
Transcript: ENSMUST00000028279
AA Change: D366G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028279
Gene: ENSMUSG00000026915
AA Change: D366G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000072186
AA Change: D366G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000072047
Gene: ENSMUSG00000026915
AA Change: D366G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183690
AA Change: D366G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915
AA Change: D366G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Meta Mutation Damage Score 0.2231 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit premature death, a reduced body size and an abnormal clutching reflex. Minor brain abnormalities and spermatogenesis defects were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Strbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Strbp APN 2 37586504 splice site probably benign
IGL00656:Strbp APN 2 37603138 splice site probably benign
IGL01376:Strbp APN 2 37645651 missense probably damaging 1.00
IGL01998:Strbp APN 2 37625285 missense probably damaging 1.00
IGL02347:Strbp APN 2 37645648 missense probably benign 0.25
IGL02453:Strbp APN 2 37586508 critical splice donor site probably null
IGL02804:Strbp APN 2 37624486 splice site probably benign
IGL03102:Strbp APN 2 37586503 splice site probably benign
PIT4418001:Strbp UTSW 2 37645492 missense probably benign
R0382:Strbp UTSW 2 37600826 missense probably benign 0.00
R0575:Strbp UTSW 2 37640873 missense possibly damaging 0.87
R0610:Strbp UTSW 2 37584077 missense probably damaging 0.97
R0825:Strbp UTSW 2 37635527 missense probably benign 0.00
R1829:Strbp UTSW 2 37640909 missense possibly damaging 0.63
R1831:Strbp UTSW 2 37625265 missense possibly damaging 0.71
R3416:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R3417:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R4673:Strbp UTSW 2 37645679 missense probably damaging 1.00
R5093:Strbp UTSW 2 37627487 missense probably damaging 0.99
R5099:Strbp UTSW 2 37603018 missense probably damaging 0.98
R5269:Strbp UTSW 2 37627443 missense possibly damaging 0.87
R5378:Strbp UTSW 2 37599174 missense probably damaging 1.00
R5378:Strbp UTSW 2 37600806 missense probably benign 0.03
R5454:Strbp UTSW 2 37645483 missense probably benign 0.00
R5905:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6028:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6374:Strbp UTSW 2 37603008 missense probably damaging 1.00
R6800:Strbp UTSW 2 37625216 missense probably damaging 1.00
R7032:Strbp UTSW 2 37603113 missense possibly damaging 0.92
R7139:Strbp UTSW 2 37624502 missense probably benign 0.00
R7261:Strbp UTSW 2 37641137 intron probably null
R7481:Strbp UTSW 2 37600754 missense probably benign 0.02
R7718:Strbp UTSW 2 37625282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCATTGATGTCTTAAGCAATG -3'
(R):5'- GCATAAACTCCTTCTCAACCATCATTG -3'

Sequencing Primer
(F):5'- CAAAGTCAATGCAATTCTTCC -3'
(R):5'- TCATAAACGTGGGCATACCTG -3'
Posted On2018-07-24