Incidental Mutation 'R6700:Tbx5'
ID528203
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6700 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119871397 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000018407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407]
Predicted Effect probably benign
Transcript: ENSMUST00000018407
AA Change: T324A

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119845113 unclassified probably null
R2011:Tbx5 UTSW 5 119841906 splice site probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R2302:Tbx5 UTSW 5 119841859 missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6218:Tbx5 UTSW 5 119853598 missense probably damaging 1.00
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R7801:Tbx5 UTSW 5 119836999 missense probably benign 0.44
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGGCACAAAGTCACCTCC -3'
(R):5'- TCCAGGGAGAAGCTGAACTG -3'

Sequencing Primer
(F):5'- TCCAACCACAGCCCCTTCAG -3'
(R):5'- GAACCTCTTACTTTTACTGACATGG -3'
Posted On2018-07-24