Incidental Mutation 'R6700:Gm19410'
ID528218
Institutional Source Beutler Lab
Gene Symbol Gm19410
Ensembl Gene ENSMUSG00000109372
Gene Namepredicted gene, 19410
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R6700 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35765790-35818047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35807510 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1495 (L1495H)
Ref Sequence ENSEMBL: ENSMUSP00000147162 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207505
AA Change: L1495H

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Gm19410
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0046:Gm19410 UTSW 8 35802645 missense probably benign 0.31
R6026:Gm19410 UTSW 8 35812426 missense probably benign 0.03
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6039:Gm19410 UTSW 8 35809364 missense probably benign 0.44
R6185:Gm19410 UTSW 8 35807510 missense possibly damaging 0.87
R6239:Gm19410 UTSW 8 35778764 missense probably damaging 0.98
R6303:Gm19410 UTSW 8 35807560 missense possibly damaging 0.96
R6377:Gm19410 UTSW 8 35803582 nonsense probably null
R6545:Gm19410 UTSW 8 35790498 missense possibly damaging 0.93
R6720:Gm19410 UTSW 8 35807576 missense probably benign 0.12
R6795:Gm19410 UTSW 8 35795522 missense probably damaging 0.98
R6808:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6810:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6811:Gm19410 UTSW 8 35772579 missense probably damaging 0.99
R6966:Gm19410 UTSW 8 35817973 missense possibly damaging 0.84
R7264:Gm19410 UTSW 8 35785766 missense probably benign 0.01
R7267:Gm19410 UTSW 8 35814843 missense possibly damaging 0.80
R7355:Gm19410 UTSW 8 35807072 missense probably benign 0.00
R7423:Gm19410 UTSW 8 35804607 missense probably benign 0.28
R7494:Gm19410 UTSW 8 35795530 missense probably damaging 0.99
R7516:Gm19410 UTSW 8 35796279 missense probably benign 0.30
R7517:Gm19410 UTSW 8 35773618 missense possibly damaging 0.45
R7526:Gm19410 UTSW 8 35790612 missense probably damaging 0.98
R7527:Gm19410 UTSW 8 35802232 missense probably damaging 0.99
R7545:Gm19410 UTSW 8 35802625 missense probably damaging 0.99
R7549:Gm19410 UTSW 8 35799346 missense probably benign 0.20
R7564:Gm19410 UTSW 8 35806997 missense probably benign 0.00
R7615:Gm19410 UTSW 8 35796359 missense probably damaging 1.00
R7622:Gm19410 UTSW 8 35810347 missense possibly damaging 0.91
R7655:Gm19410 UTSW 8 35809099 missense probably benign
R7656:Gm19410 UTSW 8 35809099 missense probably benign
R7703:Gm19410 UTSW 8 35799385 missense probably damaging 0.98
R7750:Gm19410 UTSW 8 35807498 missense possibly damaging 0.68
R7760:Gm19410 UTSW 8 35802337 missense probably damaging 0.99
R7837:Gm19410 UTSW 8 35808980 missense possibly damaging 0.91
R7920:Gm19410 UTSW 8 35808980 missense possibly damaging 0.91
Z1176:Gm19410 UTSW 8 35792611 missense possibly damaging 0.79
Z1177:Gm19410 UTSW 8 35808965 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTTACAGGCACCATCTACAGC -3'
(R):5'- TACCTGGGTGAGAACAGTAGGC -3'

Sequencing Primer
(F):5'- ATGTTAAGCATGCATGAGGCTC -3'
(R):5'- CCTGGGTGAGAACAGTAGGCAATAC -3'
Posted On2018-07-24