Mutagenetix > Incidental Mutations

Incidental Mutation 'R6700:Cyp4v3'

528219

Institutional Source

Beutler Lab

Gene Symbol

Cyp4v3

Ensembl Gene

ENSMUSG00000079057

Gene Name

cytochrome P450, family 4, subfamily v, polypeptide 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6700 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45304944-45333216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45307093 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 34 (V34A)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095328]

Predicted Effect

probably benign
Transcript: ENSMUST00000095328
AA Change: V474A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: V474A

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:p450	51	517	2.7e-123	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000116473
AA Change: V34A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112174
Gene: ENSMUSG00000031640
AA Change: V34A

Domain	Start	End	E-Value	Type
APPLE	21	104	1.96e-40	SMART
APPLE	111	194	3.93e-40	SMART
APPLE	201	284	2.65e-37	SMART
APPLE	292	375	1.34e-33	SMART
Tryp_SPc	390	621	2.22e-99	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,973,856	E504G	unknown	Het
Aak1	G	A	6: 86,964,203	E660K	unknown	Het
Abcc9	A	G	6: 142,687,287	I243T	possibly damaging	Het
Baiap3	A	G	17: 25,244,026	S1013P	probably damaging	Het
Bdp1	A	T	13: 100,025,528	D2295E	probably benign	Het
Blm	A	G	7: 80,463,850	V1233A	possibly damaging	Het
Brsk1	G	T	7: 4,692,701	V62F	probably damaging	Het
Cacna2d1	A	G	5: 16,365,460	E1011G	probably damaging	Het
Cdh18	A	G	15: 23,474,105	Y687C	probably benign	Het
Cfap221	T	C	1: 119,955,691	E250G	possibly damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cps1	G	T	1: 67,229,523		probably null	Het
Dnah9	C	T	11: 65,955,366	V2949M	probably damaging	Het
Dst	A	C	1: 34,256,323	Q3454P	probably damaging	Het
Filip1l	T	C	16: 57,571,248	L495P	possibly damaging	Het
Flnb	C	A	14: 7,892,189	H619Q	probably damaging	Het
Fst	G	C	13: 114,458,507	A27G	probably benign	Het
Ggnbp2	C	A	11: 84,840,105	R364L	probably damaging	Het
Gins1	C	T	2: 150,916,228	A78V	probably damaging	Het
Gm19410	T	A	8: 35,807,510	L1495H	possibly damaging	Het
Golgb1	C	T	16: 36,875,584		probably benign	Het
Lin7a	A	G	10: 107,380,306		probably null	Het
Lrp6	A	T	6: 134,479,560	C914S	probably damaging	Het
Lrrc8e	G	A	8: 4,236,034	G753D	probably damaging	Het
Mapk4	A	G	18: 73,930,811	Y447H	probably damaging	Het
Mbl1	A	G	14: 41,158,554	N133S	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nbea	T	C	3: 56,082,448	N329S	possibly damaging	Het
Olfr1477	A	T	19: 13,502,813	I157F	probably damaging	Het
Olfr427	G	A	1: 174,099,839	C127Y	probably damaging	Het
Olfr62	A	T	4: 118,666,412	K298N	probably benign	Het
Olfr633	G	A	7: 103,947,324	V253M	probably damaging	Het
Pik3c3	A	G	18: 30,316,901	E589G	probably benign	Het
Plb1	A	T	5: 32,333,464	D1035V	probably damaging	Het
Plekhg1	G	T	10: 3,957,373	M763I	probably benign	Het
Poc5	A	G	13: 96,394,495	N67S	probably benign	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rbm27	A	G	18: 42,325,939	Y735C	probably damaging	Het
Rhpn2	A	T	7: 35,376,169	N257I	possibly damaging	Het
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rp1	G	A	1: 4,349,896	T331M	probably damaging	Het
Sh3pxd2a	A	G	19: 47,364,707	V105A	possibly damaging	Het
Slc9a9	T	C	9: 94,936,311	S253P	possibly damaging	Het
St8sia3	C	T	18: 64,265,381		probably benign	Het
Strbp	T	C	2: 37,603,963	D366G	probably null	Het
Tbx5	A	G	5: 119,871,397	T324A	probably benign	Het
Tex15	T	A	8: 33,574,889	I1449N	possibly damaging	Het
Tmtc3	C	T	10: 100,471,477	V222I	probably benign	Het
Top3b	T	C	16: 16,892,669	S788P	possibly damaging	Het
Tsc22d4	A	G	5: 137,758,523	D71G	probably benign	Het
Tubgcp4	T	A	2: 121,189,848	V434E	probably benign	Het
Ufsp1	A	G	5: 137,294,896	Y36C	possibly damaging	Het
Unc79	T	A	12: 103,125,703	H1956Q	possibly damaging	Het
Usp34	A	T	11: 23,439,011	N2217I	probably damaging	Het
Vmn2r112	A	T	17: 22,603,481	D380V	possibly damaging	Het
Vmn2r13	A	G	5: 109,175,072	I117T	probably benign	Het
Vmn2r53	A	G	7: 12,581,706	Y729H	probably damaging	Het
Wnt3a	A	T	11: 59,249,761	L310M	probably damaging	Het
Zc3h7a	T	C	16: 11,158,967	Q155R	possibly damaging	Het

Other mutations in Cyp4v3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Cyp4v3	APN	8	45307003	missense	probably benign	0.04
IGL00503:Cyp4v3	APN	8	45307021	missense	probably damaging	0.98
IGL00757:Cyp4v3	APN	8	45320615	missense	probably damaging	0.98
IGL02375:Cyp4v3	APN	8	45308374	splice site	probably null
IGL02565:Cyp4v3	APN	8	45320637	missense	possibly damaging	0.63
IGL02881:Cyp4v3	APN	8	45308716	missense	probably damaging	1.00
R0745:Cyp4v3	UTSW	8	45308651	unclassified	probably benign
R1818:Cyp4v3	UTSW	8	45315636	missense	possibly damaging	0.77
R1819:Cyp4v3	UTSW	8	45315636	missense	possibly damaging	0.77
R1902:Cyp4v3	UTSW	8	45306952	missense	probably benign	0.00
R2426:Cyp4v3	UTSW	8	45317776	missense	probably benign
R3747:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R3748:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R3750:Cyp4v3	UTSW	8	45315708	nonsense	probably null
R4289:Cyp4v3	UTSW	8	45328223	missense	possibly damaging	0.46
R4569:Cyp4v3	UTSW	8	45306992	missense	probably damaging	1.00
R4960:Cyp4v3	UTSW	8	45320637	missense	possibly damaging	0.63
R5260:Cyp4v3	UTSW	8	45306980	missense	probably damaging	1.00
R5479:Cyp4v3	UTSW	8	45310206	missense	probably benign	0.00
R5667:Cyp4v3	UTSW	8	45308535	missense	possibly damaging	0.94
R5940:Cyp4v3	UTSW	8	45321784	missense	probably damaging	1.00
R6102:Cyp4v3	UTSW	8	45320160	missense	probably damaging	1.00
R6470:Cyp4v3	UTSW	8	45317736	nonsense	probably null
R6592:Cyp4v3	UTSW	8	45306981	missense	probably benign	0.02
R7027:Cyp4v3	UTSW	8	45310252	missense	possibly damaging	0.93
R7341:Cyp4v3	UTSW	8	45321750	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TAAAGTCACAGCTTGAGGATGG -3'
(R):5'- GTCCACAGTACTGTAAAAGTCAAG -3'

Sequencing Primer
(F):5'- TCACAGCTTGAGGATGGAGTTAG -3'
(R):5'- CTGTAAAAGTCAAGATTGTCTGGCTG -3'

Posted On

2018-07-24