Incidental Mutation 'R6700:Tmtc3'
ID528224
Institutional Source Beutler Lab
Gene Symbol Tmtc3
Ensembl Gene ENSMUSG00000036676
Gene Nametransmembrane and tetratricopeptide repeat containing 3
SynonymsB130008E12Rik, mSmile, 9130014E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6700 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location100443902-100487350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100471477 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 222 (V222I)
Ref Sequence ENSEMBL: ENSMUSP00000061470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318]
Predicted Effect probably benign
Transcript: ENSMUST00000058154
AA Change: V222I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676
AA Change: V222I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099318
AA Change: V222I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676
AA Change: V222I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130883
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired bronchial smooth muscle and alveolar myofibroblast development that leads to cyanosis and postnatal lethality in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Fst G C 13: 114,458,507 A27G probably benign Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Tmtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tmtc3 APN 10 100471480 missense probably benign
IGL00962:Tmtc3 APN 10 100471953 missense probably damaging 1.00
IGL01670:Tmtc3 APN 10 100447125 missense probably benign 0.02
IGL01729:Tmtc3 APN 10 100447155 missense probably benign
IGL01933:Tmtc3 APN 10 100447605 missense probably benign 0.00
IGL01961:Tmtc3 APN 10 100447031 missense probably benign
IGL03063:Tmtc3 APN 10 100447606 missense probably benign 0.00
IGL03176:Tmtc3 APN 10 100466131 missense possibly damaging 0.57
IGL03195:Tmtc3 APN 10 100459034 missense probably benign 0.00
IGL03238:Tmtc3 APN 10 100477840 missense probably damaging 1.00
IGL03272:Tmtc3 APN 10 100457080 missense probably benign 0.00
IGL03335:Tmtc3 APN 10 100466254 missense probably damaging 0.97
IGL03375:Tmtc3 APN 10 100447719 missense possibly damaging 0.67
IGL03409:Tmtc3 APN 10 100451432 missense possibly damaging 0.75
R0078:Tmtc3 UTSW 10 100448961 missense probably damaging 1.00
R0121:Tmtc3 UTSW 10 100458908 splice site probably benign
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0480:Tmtc3 UTSW 10 100471404 missense probably damaging 1.00
R1136:Tmtc3 UTSW 10 100472043 unclassified probably benign
R1203:Tmtc3 UTSW 10 100476744 missense probably damaging 1.00
R1253:Tmtc3 UTSW 10 100451390 missense probably benign 0.05
R2181:Tmtc3 UTSW 10 100448973 missense probably benign 0.00
R3011:Tmtc3 UTSW 10 100447582 missense possibly damaging 0.76
R3430:Tmtc3 UTSW 10 100447575 missense probably benign 0.29
R3910:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3911:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3912:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R4773:Tmtc3 UTSW 10 100457139 missense possibly damaging 0.66
R4838:Tmtc3 UTSW 10 100466220 missense probably damaging 1.00
R4996:Tmtc3 UTSW 10 100447224 missense probably damaging 0.99
R5131:Tmtc3 UTSW 10 100448979 missense probably damaging 1.00
R5976:Tmtc3 UTSW 10 100476672 missense probably benign 0.00
R7187:Tmtc3 UTSW 10 100477912 missense probably damaging 1.00
R7211:Tmtc3 UTSW 10 100447605 missense probably benign 0.05
R7299:Tmtc3 UTSW 10 100447474 missense not run
R7301:Tmtc3 UTSW 10 100447474 missense not run
R7329:Tmtc3 UTSW 10 100447419 missense probably benign 0.00
R7509:Tmtc3 UTSW 10 100466094 missense probably damaging 1.00
R7614:Tmtc3 UTSW 10 100450352 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACTGAAGACGATTTGGAAC -3'
(R):5'- AATTGTTCAGCTCAGTGTTTGCC -3'

Sequencing Primer
(F):5'- ACGTATGATGGCTGACAACC -3'
(R):5'- CAGCTCAGTGTTTGCCAAAGATATC -3'
Posted On2018-07-24