Mutagenetix > Incidental Mutations

Incidental Mutation 'R6700:Usp34'

528225

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R6700 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23439011 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 2217 (N2217I)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]

Predicted Effect

probably damaging
Transcript: ENSMUST00000130131
AA Change: N458I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342
AA Change: N458I

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
Pfam:UCH	171	514	1.1e-48	PFAM
Pfam:UCH_1	172	470	1.6e-25	PFAM
low complexity region	763	785	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: N2236I

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: N2236I

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000180046
AA Change: N2217I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: N2217I

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Meta Mutation Damage Score

0.2646

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,973,856	E504G	unknown	Het
Aak1	G	A	6: 86,964,203	E660K	unknown	Het
Abcc9	A	G	6: 142,687,287	I243T	possibly damaging	Het
Baiap3	A	G	17: 25,244,026	S1013P	probably damaging	Het
Bdp1	A	T	13: 100,025,528	D2295E	probably benign	Het
Blm	A	G	7: 80,463,850	V1233A	possibly damaging	Het
Brsk1	G	T	7: 4,692,701	V62F	probably damaging	Het
Cacna2d1	A	G	5: 16,365,460	E1011G	probably damaging	Het
Cdh18	A	G	15: 23,474,105	Y687C	probably benign	Het
Cfap221	T	C	1: 119,955,691	E250G	possibly damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cps1	G	T	1: 67,229,523		probably null	Het
Cyp4v3	A	G	8: 45,307,093	V34A	probably damaging	Het
Dnah9	C	T	11: 65,955,366	V2949M	probably damaging	Het
Dst	A	C	1: 34,256,323	Q3454P	probably damaging	Het
Filip1l	T	C	16: 57,571,248	L495P	possibly damaging	Het
Flnb	C	A	14: 7,892,189	H619Q	probably damaging	Het
Fst	G	C	13: 114,458,507	A27G	probably benign	Het
Ggnbp2	C	A	11: 84,840,105	R364L	probably damaging	Het
Gins1	C	T	2: 150,916,228	A78V	probably damaging	Het
Gm19410	T	A	8: 35,807,510	L1495H	possibly damaging	Het
Golgb1	C	T	16: 36,875,584		probably benign	Het
Lin7a	A	G	10: 107,380,306		probably null	Het
Lrp6	A	T	6: 134,479,560	C914S	probably damaging	Het
Lrrc8e	G	A	8: 4,236,034	G753D	probably damaging	Het
Mapk4	A	G	18: 73,930,811	Y447H	probably damaging	Het
Mbl1	A	G	14: 41,158,554	N133S	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nbea	T	C	3: 56,082,448	N329S	possibly damaging	Het
Olfr1477	A	T	19: 13,502,813	I157F	probably damaging	Het
Olfr427	G	A	1: 174,099,839	C127Y	probably damaging	Het
Olfr62	A	T	4: 118,666,412	K298N	probably benign	Het
Olfr633	G	A	7: 103,947,324	V253M	probably damaging	Het
Pik3c3	A	G	18: 30,316,901	E589G	probably benign	Het
Plb1	A	T	5: 32,333,464	D1035V	probably damaging	Het
Plekhg1	G	T	10: 3,957,373	M763I	probably benign	Het
Poc5	A	G	13: 96,394,495	N67S	probably benign	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rbm27	A	G	18: 42,325,939	Y735C	probably damaging	Het
Rhpn2	A	T	7: 35,376,169	N257I	possibly damaging	Het
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rp1	G	A	1: 4,349,896	T331M	probably damaging	Het
Sh3pxd2a	A	G	19: 47,364,707	V105A	possibly damaging	Het
Slc9a9	T	C	9: 94,936,311	S253P	possibly damaging	Het
St8sia3	C	T	18: 64,265,381		probably benign	Het
Strbp	T	C	2: 37,603,963	D366G	probably null	Het
Tbx5	A	G	5: 119,871,397	T324A	probably benign	Het
Tex15	T	A	8: 33,574,889	I1449N	possibly damaging	Het
Tmtc3	C	T	10: 100,471,477	V222I	probably benign	Het
Top3b	T	C	16: 16,892,669	S788P	possibly damaging	Het
Tsc22d4	A	G	5: 137,758,523	D71G	probably benign	Het
Tubgcp4	T	A	2: 121,189,848	V434E	probably benign	Het
Ufsp1	A	G	5: 137,294,896	Y36C	possibly damaging	Het
Unc79	T	A	12: 103,125,703	H1956Q	possibly damaging	Het
Vmn2r112	A	T	17: 22,603,481	D380V	possibly damaging	Het
Vmn2r13	A	G	5: 109,175,072	I117T	probably benign	Het
Vmn2r53	A	G	7: 12,581,706	Y729H	probably damaging	Het
Wnt3a	A	T	11: 59,249,761	L310M	probably damaging	Het
Zc3h7a	T	C	16: 11,158,967	Q155R	possibly damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	synonymous	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3874:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- CTACATGTTTTCAAAATGGCTGTCG -3'
(R):5'- ACATGAAAGAAAGTCTGACTTCCACTG -3'

Sequencing Primer
(F):5'- CAAAATGGCTGTCGTTATGTCATG -3'
(R):5'- GAAAGTCTGACTTCCACTGATCTG -3'

Posted On

2018-07-24