Incidental Mutation 'R6700:Bdp1'
ID 528232
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene Name B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms Tfnr, TFIIIB90, TFC5, B130055N23Rik, TAF3B1, TFIIIB150, G630013P12Rik
MMRRC Submission 044818-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6700 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100154502-100240578 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100162036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2295 (D2295E)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
AlphaFold Q571C7
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: D2295E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: D2295E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: D2295E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: D2295E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,881,140 (GRCm39) E504G unknown Het
Aak1 G A 6: 86,941,185 (GRCm39) E660K unknown Het
Abcc9 A G 6: 142,633,013 (GRCm39) I243T possibly damaging Het
Baiap3 A G 17: 25,463,000 (GRCm39) S1013P probably damaging Het
Blm A G 7: 80,113,598 (GRCm39) V1233A possibly damaging Het
Brsk1 G T 7: 4,695,700 (GRCm39) V62F probably damaging Het
Cacna2d1 A G 5: 16,570,458 (GRCm39) E1011G probably damaging Het
Cdh18 A G 15: 23,474,191 (GRCm39) Y687C probably benign Het
Cfap221 T C 1: 119,883,421 (GRCm39) E250G possibly damaging Het
Col5a3 C T 9: 20,690,329 (GRCm39) G1162R probably damaging Het
Cps1 G T 1: 67,268,682 (GRCm39) probably null Het
Cyp4v3 A G 8: 45,760,130 (GRCm39) V34A probably damaging Het
Dnah9 C T 11: 65,846,192 (GRCm39) V2949M probably damaging Het
Dst A C 1: 34,295,404 (GRCm39) Q3454P probably damaging Het
Filip1l T C 16: 57,391,611 (GRCm39) L495P possibly damaging Het
Flnb C A 14: 7,892,189 (GRCm38) H619Q probably damaging Het
Fst G C 13: 114,595,043 (GRCm39) A27G probably benign Het
Ggnbp2 C A 11: 84,730,931 (GRCm39) R364L probably damaging Het
Gins1 C T 2: 150,758,148 (GRCm39) A78V probably damaging Het
Gm19410 T A 8: 36,274,664 (GRCm39) L1495H possibly damaging Het
Golgb1 C T 16: 36,695,946 (GRCm39) probably benign Het
Lin7a A G 10: 107,216,167 (GRCm39) probably null Het
Lrp6 A T 6: 134,456,523 (GRCm39) C914S probably damaging Het
Lrrc8e G A 8: 4,286,034 (GRCm39) G753D probably damaging Het
Mapk4 A G 18: 74,063,882 (GRCm39) Y447H probably damaging Het
Mbl1 A G 14: 40,880,511 (GRCm39) N133S probably damaging Het
Mrps30 A T 13: 118,517,134 (GRCm39) S362T probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Nbea T C 3: 55,989,869 (GRCm39) N329S possibly damaging Het
Or13p10 A T 4: 118,523,609 (GRCm39) K298N probably benign Het
Or51k2 G A 7: 103,596,531 (GRCm39) V253M probably damaging Het
Or5b120 A T 19: 13,480,177 (GRCm39) I157F probably damaging Het
Or6k14 G A 1: 173,927,405 (GRCm39) C127Y probably damaging Het
Pik3c3 A G 18: 30,449,954 (GRCm39) E589G probably benign Het
Plb1 A T 5: 32,490,808 (GRCm39) D1035V probably damaging Het
Plekhg1 G T 10: 3,907,373 (GRCm39) M763I probably benign Het
Poc5 A G 13: 96,531,003 (GRCm39) N67S probably benign Het
Psmd13 T A 7: 140,470,522 (GRCm39) W255R probably damaging Het
Rbm27 A G 18: 42,459,004 (GRCm39) Y735C probably damaging Het
Rhpn2 A T 7: 35,075,594 (GRCm39) N257I possibly damaging Het
Rilpl2 C T 5: 124,607,843 (GRCm39) E126K probably damaging Het
Rp1 G A 1: 4,420,119 (GRCm39) T331M probably damaging Het
Sh3pxd2a A G 19: 47,353,146 (GRCm39) V105A possibly damaging Het
Slc9a9 T C 9: 94,818,364 (GRCm39) S253P possibly damaging Het
St8sia3 C T 18: 64,398,452 (GRCm39) probably benign Het
Strbp T C 2: 37,493,975 (GRCm39) D366G probably null Het
Tbx5 A G 5: 120,009,462 (GRCm39) T324A probably benign Het
Tex15 T A 8: 34,064,917 (GRCm39) I1449N possibly damaging Het
Tmtc3 C T 10: 100,307,339 (GRCm39) V222I probably benign Het
Top3b T C 16: 16,710,533 (GRCm39) S788P possibly damaging Het
Tsc22d4 A G 5: 137,756,785 (GRCm39) D71G probably benign Het
Tubgcp4 T A 2: 121,020,329 (GRCm39) V434E probably benign Het
Ufsp1 A G 5: 137,293,158 (GRCm39) Y36C possibly damaging Het
Unc79 T A 12: 103,091,962 (GRCm39) H1956Q possibly damaging Het
Usp34 A T 11: 23,389,011 (GRCm39) N2217I probably damaging Het
Vmn2r112 A T 17: 22,822,462 (GRCm39) D380V possibly damaging Het
Vmn2r13 A G 5: 109,322,938 (GRCm39) I117T probably benign Het
Vmn2r53 A G 7: 12,315,633 (GRCm39) Y729H probably damaging Het
Wnt3a A T 11: 59,140,587 (GRCm39) L310M probably damaging Het
Zc3h7a T C 16: 10,976,831 (GRCm39) Q155R possibly damaging Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100,235,018 (GRCm39) missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100,197,373 (GRCm39) missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100,197,706 (GRCm39) missense probably benign 0.00
IGL00924:Bdp1 APN 13 100,234,087 (GRCm39) missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100,192,700 (GRCm39) missense probably benign 0.00
IGL01344:Bdp1 APN 13 100,214,588 (GRCm39) missense probably benign 0.06
IGL01347:Bdp1 APN 13 100,206,711 (GRCm39) missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100,220,713 (GRCm39) splice site probably benign
IGL01871:Bdp1 APN 13 100,202,561 (GRCm39) missense probably benign 0.01
IGL02008:Bdp1 APN 13 100,160,335 (GRCm39) missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100,174,308 (GRCm39) missense probably benign 0.02
IGL02214:Bdp1 APN 13 100,178,043 (GRCm39) missense probably benign 0.00
IGL02236:Bdp1 APN 13 100,197,399 (GRCm39) missense probably benign
IGL02307:Bdp1 APN 13 100,229,946 (GRCm39) missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100,191,816 (GRCm39) splice site probably benign
IGL02415:Bdp1 APN 13 100,225,916 (GRCm39) missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100,235,022 (GRCm39) missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100,214,623 (GRCm39) critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100,188,047 (GRCm39) missense probably benign 0.29
IGL02738:Bdp1 APN 13 100,187,861 (GRCm39) missense probably benign 0.26
IGL02754:Bdp1 APN 13 100,197,481 (GRCm39) missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100,178,778 (GRCm39) missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100,191,800 (GRCm39) missense probably benign 0.00
IGL03156:Bdp1 APN 13 100,197,544 (GRCm39) missense probably benign 0.44
IGL03166:Bdp1 APN 13 100,172,308 (GRCm39) missense probably benign 0.28
IGL03232:Bdp1 APN 13 100,187,989 (GRCm39) missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100,160,129 (GRCm39) missense probably benign 0.02
R0115:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0481:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0619:Bdp1 UTSW 13 100,174,366 (GRCm39) missense probably benign 0.00
R0730:Bdp1 UTSW 13 100,195,459 (GRCm39) splice site probably benign
R0744:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R0833:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R1307:Bdp1 UTSW 13 100,186,271 (GRCm39) missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100,235,516 (GRCm39) missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100,215,263 (GRCm39) nonsense probably null
R1644:Bdp1 UTSW 13 100,197,448 (GRCm39) missense probably benign 0.03
R1670:Bdp1 UTSW 13 100,163,941 (GRCm39) critical splice donor site probably null
R1836:Bdp1 UTSW 13 100,171,653 (GRCm39) missense probably benign
R1869:Bdp1 UTSW 13 100,178,709 (GRCm39) missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100,235,097 (GRCm39) missense probably benign 0.30
R1944:Bdp1 UTSW 13 100,210,889 (GRCm39) splice site probably null
R2030:Bdp1 UTSW 13 100,197,697 (GRCm39) missense probably benign 0.00
R2069:Bdp1 UTSW 13 100,187,496 (GRCm39) missense probably benign 0.00
R2180:Bdp1 UTSW 13 100,197,913 (GRCm39) small insertion probably benign
R2263:Bdp1 UTSW 13 100,202,545 (GRCm39) missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2277:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2278:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2336:Bdp1 UTSW 13 100,189,510 (GRCm39) missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100,196,878 (GRCm39) missense probably benign 0.08
R3154:Bdp1 UTSW 13 100,186,322 (GRCm39) missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100,196,093 (GRCm39) missense probably benign
R4322:Bdp1 UTSW 13 100,228,731 (GRCm39) missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100,167,369 (GRCm39) missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100,167,369 (GRCm39) missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100,192,775 (GRCm39) missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100,186,376 (GRCm39) missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100,187,627 (GRCm39) missense probably benign 0.26
R4914:Bdp1 UTSW 13 100,192,844 (GRCm39) missense probably benign 0.28
R4917:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100,167,302 (GRCm39) nonsense probably null
R5266:Bdp1 UTSW 13 100,204,043 (GRCm39) missense probably benign 0.33
R5312:Bdp1 UTSW 13 100,234,109 (GRCm39) splice site probably null
R5420:Bdp1 UTSW 13 100,202,551 (GRCm39) missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100,235,018 (GRCm39) missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100,228,794 (GRCm39) missense probably benign 0.08
R5913:Bdp1 UTSW 13 100,187,612 (GRCm39) missense probably benign 0.41
R6018:Bdp1 UTSW 13 100,174,732 (GRCm39) missense probably benign 0.00
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6969:Bdp1 UTSW 13 100,211,039 (GRCm39) missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100,174,269 (GRCm39) missense probably null 1.00
R6996:Bdp1 UTSW 13 100,180,321 (GRCm39) missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100,215,215 (GRCm39) missense probably benign 0.03
R7060:Bdp1 UTSW 13 100,196,002 (GRCm39) missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100,206,689 (GRCm39) missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100,197,659 (GRCm39) missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100,178,040 (GRCm39) missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100,187,457 (GRCm39) missense probably benign 0.03
R7562:Bdp1 UTSW 13 100,162,049 (GRCm39) missense probably benign 0.04
R7583:Bdp1 UTSW 13 100,186,320 (GRCm39) missense probably damaging 1.00
R7788:Bdp1 UTSW 13 100,191,759 (GRCm39) missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100,235,637 (GRCm39) missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100,228,832 (GRCm39) missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100,177,944 (GRCm39) missense probably benign 0.37
R7975:Bdp1 UTSW 13 100,156,884 (GRCm39) missense probably benign 0.01
R7999:Bdp1 UTSW 13 100,195,404 (GRCm39) missense possibly damaging 0.93
R8126:Bdp1 UTSW 13 100,192,790 (GRCm39) missense probably damaging 1.00
R8340:Bdp1 UTSW 13 100,202,476 (GRCm39) missense possibly damaging 0.61
R8414:Bdp1 UTSW 13 100,200,985 (GRCm39) missense probably benign 0.03
R8468:Bdp1 UTSW 13 100,197,076 (GRCm39) missense probably benign 0.04
R8688:Bdp1 UTSW 13 100,240,307 (GRCm39) missense probably damaging 1.00
R8871:Bdp1 UTSW 13 100,186,175 (GRCm39) missense probably damaging 1.00
R8976:Bdp1 UTSW 13 100,197,407 (GRCm39) nonsense probably null
R8987:Bdp1 UTSW 13 100,204,021 (GRCm39) missense probably benign 0.01
R9157:Bdp1 UTSW 13 100,186,436 (GRCm39) missense probably benign 0.40
R9437:Bdp1 UTSW 13 100,162,158 (GRCm39) missense probably benign 0.31
R9612:Bdp1 UTSW 13 100,214,370 (GRCm39) missense probably benign 0.18
R9679:Bdp1 UTSW 13 100,180,285 (GRCm39) missense probably damaging 0.98
RF003:Bdp1 UTSW 13 100,196,958 (GRCm39) missense probably benign 0.31
RF003:Bdp1 UTSW 13 100,196,957 (GRCm39) missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100,197,904 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAGAGACAGTCACTAC -3'
(R):5'- GCTGGGTTTGTTATAGAACACCATG -3'

Sequencing Primer
(F):5'- CAGAGTCTCTAATAATACCTGGTCAG -3'
(R):5'- ATAGAACACCATGGGTTTTTCCTTC -3'
Posted On 2018-07-24