Incidental Mutation 'R6700:Fst'
ID 528233
Institutional Source Beutler Lab
Gene Symbol Fst
Ensembl Gene ENSMUSG00000021765
Gene Name follistatin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock # R6700 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 114452290-114458951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 114458507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 27 (A27G)
Ref Sequence ENSEMBL: ENSMUSP00000156375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022287] [ENSMUST00000223640] [ENSMUST00000231252]
AlphaFold P47931
Predicted Effect probably benign
Transcript: ENSMUST00000022287
AA Change: A27G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: A27G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FOLN 94 117 2.44e-8 SMART
KAZAL 117 164 9.1e-17 SMART
FOLN 167 190 6.45e-8 SMART
KAZAL 191 239 3.73e-13 SMART
FOLN 243 267 2.09e-7 SMART
KAZAL 265 315 3.03e-13 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223640
AA Change: A27G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223865
Predicted Effect probably benign
Transcript: ENSMUST00000225068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225706
Predicted Effect probably benign
Transcript: ENSMUST00000231252
AA Change: A27G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231498
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,973,856 E504G unknown Het
Aak1 G A 6: 86,964,203 E660K unknown Het
Abcc9 A G 6: 142,687,287 I243T possibly damaging Het
Baiap3 A G 17: 25,244,026 S1013P probably damaging Het
Bdp1 A T 13: 100,025,528 D2295E probably benign Het
Blm A G 7: 80,463,850 V1233A possibly damaging Het
Brsk1 G T 7: 4,692,701 V62F probably damaging Het
Cacna2d1 A G 5: 16,365,460 E1011G probably damaging Het
Cdh18 A G 15: 23,474,105 Y687C probably benign Het
Cfap221 T C 1: 119,955,691 E250G possibly damaging Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Cps1 G T 1: 67,229,523 probably null Het
Cyp4v3 A G 8: 45,307,093 V34A probably damaging Het
Dnah9 C T 11: 65,955,366 V2949M probably damaging Het
Dst A C 1: 34,256,323 Q3454P probably damaging Het
Filip1l T C 16: 57,571,248 L495P possibly damaging Het
Flnb C A 14: 7,892,189 H619Q probably damaging Het
Ggnbp2 C A 11: 84,840,105 R364L probably damaging Het
Gins1 C T 2: 150,916,228 A78V probably damaging Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Golgb1 C T 16: 36,875,584 probably benign Het
Lin7a A G 10: 107,380,306 probably null Het
Lrp6 A T 6: 134,479,560 C914S probably damaging Het
Lrrc8e G A 8: 4,236,034 G753D probably damaging Het
Mapk4 A G 18: 73,930,811 Y447H probably damaging Het
Mbl1 A G 14: 41,158,554 N133S probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nbea T C 3: 56,082,448 N329S possibly damaging Het
Olfr1477 A T 19: 13,502,813 I157F probably damaging Het
Olfr427 G A 1: 174,099,839 C127Y probably damaging Het
Olfr62 A T 4: 118,666,412 K298N probably benign Het
Olfr633 G A 7: 103,947,324 V253M probably damaging Het
Pik3c3 A G 18: 30,316,901 E589G probably benign Het
Plb1 A T 5: 32,333,464 D1035V probably damaging Het
Plekhg1 G T 10: 3,957,373 M763I probably benign Het
Poc5 A G 13: 96,394,495 N67S probably benign Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rbm27 A G 18: 42,325,939 Y735C probably damaging Het
Rhpn2 A T 7: 35,376,169 N257I possibly damaging Het
Rilpl2 C T 5: 124,469,780 E126K probably damaging Het
Rp1 G A 1: 4,349,896 T331M probably damaging Het
Sh3pxd2a A G 19: 47,364,707 V105A possibly damaging Het
Slc9a9 T C 9: 94,936,311 S253P possibly damaging Het
St8sia3 C T 18: 64,265,381 probably benign Het
Strbp T C 2: 37,603,963 D366G probably null Het
Tbx5 A G 5: 119,871,397 T324A probably benign Het
Tex15 T A 8: 33,574,889 I1449N possibly damaging Het
Tmtc3 C T 10: 100,471,477 V222I probably benign Het
Top3b T C 16: 16,892,669 S788P possibly damaging Het
Tsc22d4 A G 5: 137,758,523 D71G probably benign Het
Tubgcp4 T A 2: 121,189,848 V434E probably benign Het
Ufsp1 A G 5: 137,294,896 Y36C possibly damaging Het
Unc79 T A 12: 103,125,703 H1956Q possibly damaging Het
Usp34 A T 11: 23,439,011 N2217I probably damaging Het
Vmn2r112 A T 17: 22,603,481 D380V possibly damaging Het
Vmn2r13 A G 5: 109,175,072 I117T probably benign Het
Vmn2r53 A G 7: 12,581,706 Y729H probably damaging Het
Wnt3a A T 11: 59,249,761 L310M probably damaging Het
Zc3h7a T C 16: 11,158,967 Q155R possibly damaging Het
Other mutations in Fst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Fst APN 13 114454360 missense probably damaging 1.00
IGL02213:Fst APN 13 114455854 missense possibly damaging 0.51
R0631:Fst UTSW 13 114454502 missense possibly damaging 0.91
R1391:Fst UTSW 13 114454279 critical splice donor site probably benign
R4884:Fst UTSW 13 114454384 missense probably damaging 1.00
R5326:Fst UTSW 13 114455705 missense probably damaging 1.00
R5542:Fst UTSW 13 114455705 missense probably damaging 1.00
R7319:Fst UTSW 13 114458532 missense probably benign 0.09
R8281:Fst UTSW 13 114455241 missense probably benign 0.02
R8830:Fst UTSW 13 114455828 missense probably damaging 1.00
R8910:Fst UTSW 13 114453709 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATCCTAAAGTGTCACTGCCTTCAG -3'
(R):5'- TGACGTCCATTGAATCGCGC -3'

Sequencing Primer
(F):5'- AGTCTTTCCCTCCCGTTCCG -3'
(R):5'- ATTGAATCGCGCGGGCGGCCGGTGG -3'
Posted On 2018-07-24