Mutagenetix > Incidental Mutation

Incidental Mutation 'R6700:Fst'

528233

Institutional Source

Beutler Lab

Gene Symbol

Fst

Ensembl Gene

ENSMUSG00000021765

Gene Name

follistatin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R6700 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114452290-114458951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 114458507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 27 (A27G)

Ref Sequence

ENSEMBL: ENSMUSP00000156375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022287] [ENSMUST00000223640] [ENSMUST00000231252]

AlphaFold

P47931

Predicted Effect

probably benign
Transcript: ENSMUST00000022287
AA Change: A27G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000022287
Gene: ENSMUSG00000021765
AA Change: A27G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
FOLN	94	117	2.44e-8	SMART
KAZAL	117	164	9.1e-17	SMART
FOLN	167	190	6.45e-8	SMART
KAZAL	191	239	3.73e-13	SMART
FOLN	243	267	2.09e-7	SMART
KAZAL	265	315	3.03e-13	SMART
low complexity region	320	329	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223640
AA Change: A27G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223865

Predicted Effect

probably benign
Transcript: ENSMUST00000225068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225706

Predicted Effect

probably benign
Transcript: ENSMUST00000231252
AA Change: A27G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231498

Meta Mutation Damage Score

0.0746

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice show retarded growth, reduced diaphragm and intercostal muscle mass that lead to neonatal respiratory failure, shiny tight skin, defects of the hard palate and thirteenth ribs, and abnormal whiskers and teeth. Some conditional mutations produce female reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,973,856	E504G	unknown	Het
Aak1	G	A	6: 86,964,203	E660K	unknown	Het
Abcc9	A	G	6: 142,687,287	I243T	possibly damaging	Het
Baiap3	A	G	17: 25,244,026	S1013P	probably damaging	Het
Bdp1	A	T	13: 100,025,528	D2295E	probably benign	Het
Blm	A	G	7: 80,463,850	V1233A	possibly damaging	Het
Brsk1	G	T	7: 4,692,701	V62F	probably damaging	Het
Cacna2d1	A	G	5: 16,365,460	E1011G	probably damaging	Het
Cdh18	A	G	15: 23,474,105	Y687C	probably benign	Het
Cfap221	T	C	1: 119,955,691	E250G	possibly damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cps1	G	T	1: 67,229,523		probably null	Het
Cyp4v3	A	G	8: 45,307,093	V34A	probably damaging	Het
Dnah9	C	T	11: 65,955,366	V2949M	probably damaging	Het
Dst	A	C	1: 34,256,323	Q3454P	probably damaging	Het
Filip1l	T	C	16: 57,571,248	L495P	possibly damaging	Het
Flnb	C	A	14: 7,892,189	H619Q	probably damaging	Het
Ggnbp2	C	A	11: 84,840,105	R364L	probably damaging	Het
Gins1	C	T	2: 150,916,228	A78V	probably damaging	Het
Gm19410	T	A	8: 35,807,510	L1495H	possibly damaging	Het
Golgb1	C	T	16: 36,875,584		probably benign	Het
Lin7a	A	G	10: 107,380,306		probably null	Het
Lrp6	A	T	6: 134,479,560	C914S	probably damaging	Het
Lrrc8e	G	A	8: 4,236,034	G753D	probably damaging	Het
Mapk4	A	G	18: 73,930,811	Y447H	probably damaging	Het
Mbl1	A	G	14: 41,158,554	N133S	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nbea	T	C	3: 56,082,448	N329S	possibly damaging	Het
Olfr1477	A	T	19: 13,502,813	I157F	probably damaging	Het
Olfr427	G	A	1: 174,099,839	C127Y	probably damaging	Het
Olfr62	A	T	4: 118,666,412	K298N	probably benign	Het
Olfr633	G	A	7: 103,947,324	V253M	probably damaging	Het
Pik3c3	A	G	18: 30,316,901	E589G	probably benign	Het
Plb1	A	T	5: 32,333,464	D1035V	probably damaging	Het
Plekhg1	G	T	10: 3,957,373	M763I	probably benign	Het
Poc5	A	G	13: 96,394,495	N67S	probably benign	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rbm27	A	G	18: 42,325,939	Y735C	probably damaging	Het
Rhpn2	A	T	7: 35,376,169	N257I	possibly damaging	Het
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rp1	G	A	1: 4,349,896	T331M	probably damaging	Het
Sh3pxd2a	A	G	19: 47,364,707	V105A	possibly damaging	Het
Slc9a9	T	C	9: 94,936,311	S253P	possibly damaging	Het
St8sia3	C	T	18: 64,265,381		probably benign	Het
Strbp	T	C	2: 37,603,963	D366G	probably null	Het
Tbx5	A	G	5: 119,871,397	T324A	probably benign	Het
Tex15	T	A	8: 33,574,889	I1449N	possibly damaging	Het
Tmtc3	C	T	10: 100,471,477	V222I	probably benign	Het
Top3b	T	C	16: 16,892,669	S788P	possibly damaging	Het
Tsc22d4	A	G	5: 137,758,523	D71G	probably benign	Het
Tubgcp4	T	A	2: 121,189,848	V434E	probably benign	Het
Ufsp1	A	G	5: 137,294,896	Y36C	possibly damaging	Het
Unc79	T	A	12: 103,125,703	H1956Q	possibly damaging	Het
Usp34	A	T	11: 23,439,011	N2217I	probably damaging	Het
Vmn2r112	A	T	17: 22,603,481	D380V	possibly damaging	Het
Vmn2r13	A	G	5: 109,175,072	I117T	probably benign	Het
Vmn2r53	A	G	7: 12,581,706	Y729H	probably damaging	Het
Wnt3a	A	T	11: 59,249,761	L310M	probably damaging	Het
Zc3h7a	T	C	16: 11,158,967	Q155R	possibly damaging	Het

Other mutations in Fst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02147:Fst	APN	13	114454360	missense	probably damaging	1.00
IGL02213:Fst	APN	13	114455854	missense	possibly damaging	0.51
R0631:Fst	UTSW	13	114454502	missense	possibly damaging	0.91
R1391:Fst	UTSW	13	114454279	critical splice donor site	probably benign
R4884:Fst	UTSW	13	114454384	missense	probably damaging	1.00
R5326:Fst	UTSW	13	114455705	missense	probably damaging	1.00
R5542:Fst	UTSW	13	114455705	missense	probably damaging	1.00
R7319:Fst	UTSW	13	114458532	missense	probably benign	0.09
R8281:Fst	UTSW	13	114455241	missense	probably benign	0.02
R8830:Fst	UTSW	13	114455828	missense	probably damaging	1.00
R8910:Fst	UTSW	13	114453709	intron	probably benign
R9533:Fst	UTSW	13	114455861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCCTAAAGTGTCACTGCCTTCAG -3'
(R):5'- TGACGTCCATTGAATCGCGC -3'

Sequencing Primer
(F):5'- AGTCTTTCCCTCCCGTTCCG -3'
(R):5'- ATTGAATCGCGCGGGCGGCCGGTGG -3'

Posted On

2018-07-24