Mutagenetix > Incidental Mutation

Incidental Mutation 'R6700:Filip1l'

528241

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6700 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57571248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 495 (L495P)

Ref Sequence

ENSEMBL: ENSMUSP00000124069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159414
AA Change: L495P

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: L495P

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159816
AA Change: L733P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: L733P

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Meta Mutation Damage Score

0.0858

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,973,856	E504G	unknown	Het
Aak1	G	A	6: 86,964,203	E660K	unknown	Het
Abcc9	A	G	6: 142,687,287	I243T	possibly damaging	Het
Baiap3	A	G	17: 25,244,026	S1013P	probably damaging	Het
Bdp1	A	T	13: 100,025,528	D2295E	probably benign	Het
Blm	A	G	7: 80,463,850	V1233A	possibly damaging	Het
Brsk1	G	T	7: 4,692,701	V62F	probably damaging	Het
Cacna2d1	A	G	5: 16,365,460	E1011G	probably damaging	Het
Cdh18	A	G	15: 23,474,105	Y687C	probably benign	Het
Cfap221	T	C	1: 119,955,691	E250G	possibly damaging	Het
Col5a3	C	T	9: 20,779,033	G1162R	probably damaging	Het
Cps1	G	T	1: 67,229,523		probably null	Het
Cyp4v3	A	G	8: 45,307,093	V34A	probably damaging	Het
Dnah9	C	T	11: 65,955,366	V2949M	probably damaging	Het
Dst	A	C	1: 34,256,323	Q3454P	probably damaging	Het
Flnb	C	A	14: 7,892,189	H619Q	probably damaging	Het
Fst	G	C	13: 114,458,507	A27G	probably benign	Het
Ggnbp2	C	A	11: 84,840,105	R364L	probably damaging	Het
Gins1	C	T	2: 150,916,228	A78V	probably damaging	Het
Gm19410	T	A	8: 35,807,510	L1495H	possibly damaging	Het
Golgb1	C	T	16: 36,875,584		probably benign	Het
Lin7a	A	G	10: 107,380,306		probably null	Het
Lrp6	A	T	6: 134,479,560	C914S	probably damaging	Het
Lrrc8e	G	A	8: 4,236,034	G753D	probably damaging	Het
Mapk4	A	G	18: 73,930,811	Y447H	probably damaging	Het
Mbl1	A	G	14: 41,158,554	N133S	probably damaging	Het
Mrps30	A	T	13: 118,380,598	S362T	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Nbea	T	C	3: 56,082,448	N329S	possibly damaging	Het
Olfr1477	A	T	19: 13,502,813	I157F	probably damaging	Het
Olfr427	G	A	1: 174,099,839	C127Y	probably damaging	Het
Olfr62	A	T	4: 118,666,412	K298N	probably benign	Het
Olfr633	G	A	7: 103,947,324	V253M	probably damaging	Het
Pik3c3	A	G	18: 30,316,901	E589G	probably benign	Het
Plb1	A	T	5: 32,333,464	D1035V	probably damaging	Het
Plekhg1	G	T	10: 3,957,373	M763I	probably benign	Het
Poc5	A	G	13: 96,394,495	N67S	probably benign	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rbm27	A	G	18: 42,325,939	Y735C	probably damaging	Het
Rhpn2	A	T	7: 35,376,169	N257I	possibly damaging	Het
Rilpl2	C	T	5: 124,469,780	E126K	probably damaging	Het
Rp1	G	A	1: 4,349,896	T331M	probably damaging	Het
Sh3pxd2a	A	G	19: 47,364,707	V105A	possibly damaging	Het
Slc9a9	T	C	9: 94,936,311	S253P	possibly damaging	Het
St8sia3	C	T	18: 64,265,381		probably benign	Het
Strbp	T	C	2: 37,603,963	D366G	probably null	Het
Tbx5	A	G	5: 119,871,397	T324A	probably benign	Het
Tex15	T	A	8: 33,574,889	I1449N	possibly damaging	Het
Tmtc3	C	T	10: 100,471,477	V222I	probably benign	Het
Top3b	T	C	16: 16,892,669	S788P	possibly damaging	Het
Tsc22d4	A	G	5: 137,758,523	D71G	probably benign	Het
Tubgcp4	T	A	2: 121,189,848	V434E	probably benign	Het
Ufsp1	A	G	5: 137,294,896	Y36C	possibly damaging	Het
Unc79	T	A	12: 103,125,703	H1956Q	possibly damaging	Het
Usp34	A	T	11: 23,439,011	N2217I	probably damaging	Het
Vmn2r112	A	T	17: 22,603,481	D380V	possibly damaging	Het
Vmn2r13	A	G	5: 109,175,072	I117T	probably benign	Het
Vmn2r53	A	G	7: 12,581,706	Y729H	probably damaging	Het
Wnt3a	A	T	11: 59,249,761	L310M	probably damaging	Het
Zc3h7a	T	C	16: 11,158,967	Q155R	possibly damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCAAGATGGAGCTTGCC -3'
(R):5'- TAGTCTGGTGGCTCACTGTC -3'

Sequencing Primer
(F):5'- GCTTGCCAAGTACAAGTTGG -3'
(R):5'- AATACTTGCGGGTCAGAGATTC -3'

Posted On

2018-07-24