Incidental Mutation 'R6703:Cfap54'
ID 528297
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 044821-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R6703 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 92611481-92917480 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92704596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 2828 (D2828V)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: D2763V
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: D2763V

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: D2828V
Meta Mutation Damage Score 0.1358 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,497,558 (GRCm39) Y66* probably null Het
Akap13 T C 7: 75,252,646 (GRCm39) S259P probably damaging Het
Aoc1 A C 6: 48,882,648 (GRCm39) T197P probably damaging Het
Blnk A T 19: 40,950,950 (GRCm39) probably null Het
Ccser1 A T 6: 61,615,495 (GRCm39) K94* probably null Het
Clec4n A G 6: 123,212,553 (GRCm39) Q89R probably null Het
Col6a3 T C 1: 90,707,161 (GRCm39) D1984G unknown Het
Col6a3 C T 1: 90,720,184 (GRCm39) R1552Q probably benign Het
Csnk2a1 A G 2: 152,100,608 (GRCm39) T93A probably benign Het
Dna2 T A 10: 62,809,073 (GRCm39) I1055N possibly damaging Het
Dnm3 A G 1: 162,146,256 (GRCm39) F296L probably benign Het
Dock7 T C 4: 98,834,909 (GRCm39) E1822G probably damaging Het
Dpyd A T 3: 118,690,849 (GRCm39) probably null Het
Dyrk4 A T 6: 126,867,045 (GRCm39) I329N probably damaging Het
E4f1 C A 17: 24,666,105 (GRCm39) R231L probably damaging Het
Fat1 A G 8: 45,406,083 (GRCm39) T945A probably benign Het
Fkbp7 A T 2: 76,502,106 (GRCm39) M99K probably damaging Het
Flad1 T C 3: 89,315,897 (GRCm39) S222G probably benign Het
H1f7 C A 15: 98,155,153 (GRCm39) probably benign Het
Ighg2b T C 12: 113,268,653 (GRCm39) probably benign Het
Iqub T A 6: 24,449,744 (GRCm39) N707I probably damaging Het
Itln1 C T 1: 171,358,151 (GRCm39) C199Y probably damaging Het
Kctd3 G A 1: 188,728,726 (GRCm39) R137C probably damaging Het
Lamp5 C G 2: 135,901,483 (GRCm39) N102K possibly damaging Het
Larp7 C T 3: 127,337,873 (GRCm39) M395I probably damaging Het
Lpcat3 C T 6: 124,640,185 (GRCm39) A5V probably benign Het
Lrrc43 C T 5: 123,637,532 (GRCm39) T233M possibly damaging Het
Map4k1 T G 7: 28,701,821 (GRCm39) S803A possibly damaging Het
Mef2c T A 13: 83,773,525 (GRCm39) C134S possibly damaging Het
Mgst2 T C 3: 51,572,033 (GRCm39) probably null Het
Mug2 T G 6: 122,055,653 (GRCm39) I1112R probably benign Het
Myo15a A G 11: 60,383,818 (GRCm39) I1622V probably benign Het
Ndor1 A G 2: 25,139,902 (GRCm39) F142S possibly damaging Het
Nectin3 A G 16: 46,284,205 (GRCm39) S160P probably damaging Het
Nudt16l2 T C 9: 105,021,758 (GRCm39) Y96C possibly damaging Het
Nynrin A G 14: 56,101,935 (GRCm39) T535A possibly damaging Het
Or2m13 T C 16: 19,226,122 (GRCm39) I215V probably benign Het
Or4k15 A G 14: 50,364,688 (GRCm39) Y218C probably damaging Het
Or4k42 T A 2: 111,320,454 (GRCm39) probably null Het
Or8b51 A T 9: 38,569,073 (GRCm39) I205N possibly damaging Het
Pcdh10 G A 3: 45,335,734 (GRCm39) V683M possibly damaging Het
Per2 C T 1: 91,355,671 (GRCm39) E696K probably damaging Het
Pif1 T C 9: 65,500,545 (GRCm39) V490A probably damaging Het
Plekhn1 A T 4: 156,309,250 (GRCm39) Y219N probably benign Het
Ppl T G 16: 4,907,328 (GRCm39) E989A probably damaging Het
Prkdc T G 16: 15,488,392 (GRCm39) S505A probably benign Het
Psg16 T C 7: 16,824,321 (GRCm39) L35P probably damaging Het
Ptges A G 2: 30,793,133 (GRCm39) V33A possibly damaging Het
Qser1 G A 2: 104,607,670 (GRCm39) T1416I possibly damaging Het
Rab3a A G 8: 71,209,095 (GRCm39) D77G probably damaging Het
Rtn3 A T 19: 7,412,410 (GRCm39) V788D probably damaging Het
Rtn4r T C 16: 17,969,055 (GRCm39) L161P probably damaging Het
Rtn4rl1 G A 11: 75,156,354 (GRCm39) R262Q probably benign Het
S1pr3 A T 13: 51,573,475 (GRCm39) I219F probably damaging Het
Sec23b A T 2: 144,401,109 (GRCm39) probably null Het
Senp6 A G 9: 80,029,203 (GRCm39) E522G probably damaging Het
Slc27a6 A G 18: 58,742,911 (GRCm39) N533S probably benign Het
Slc39a5 T A 10: 128,233,651 (GRCm39) D282V probably damaging Het
Smc1b C T 15: 84,976,232 (GRCm39) R825Q probably benign Het
Snx14 A G 9: 88,304,967 (GRCm39) I109T probably damaging Het
Sorl1 A T 9: 41,982,497 (GRCm39) V361E probably damaging Het
Sox5 G T 6: 143,779,191 (GRCm39) S648R probably damaging Het
Sptbn2 G A 19: 4,799,842 (GRCm39) S2161N probably benign Het
Sptbn2 C A 19: 4,799,843 (GRCm39) S2161R probably benign Het
St6galnac2 A G 11: 116,575,213 (GRCm39) S209P probably benign Het
Tmub1 T C 5: 24,651,944 (GRCm39) S7G probably benign Het
Trarg1 A T 11: 76,584,988 (GRCm39) probably null Het
Trpm5 C A 7: 142,623,055 (GRCm39) probably benign Het
Vmn2r106 C T 17: 20,488,725 (GRCm39) C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 (GRCm39) S305P probably benign Het
Zfp780b T C 7: 27,671,066 (GRCm39) T81A possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 92,917,385 (GRCm39) missense unknown
IGL02034:Cfap54 APN 10 92,897,347 (GRCm39) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 92,917,320 (GRCm39) missense unknown
IGL02434:Cfap54 APN 10 92,902,616 (GRCm39) missense probably benign 0.20
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,812,901 (GRCm39) missense probably benign 0.33
R0044:Cfap54 UTSW 10 92,871,295 (GRCm39) missense probably null 0.46
R0086:Cfap54 UTSW 10 92,864,456 (GRCm39) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 92,864,514 (GRCm39) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 92,870,524 (GRCm39) unclassified probably benign
R0234:Cfap54 UTSW 10 92,735,022 (GRCm39) nonsense probably null
R0308:Cfap54 UTSW 10 92,721,226 (GRCm39) missense unknown
R0332:Cfap54 UTSW 10 92,871,319 (GRCm39) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,612,075 (GRCm39) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,814,942 (GRCm39) splice site probably benign
R0436:Cfap54 UTSW 10 92,874,837 (GRCm39) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,710,805 (GRCm39) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,744,745 (GRCm39) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 92,860,984 (GRCm39) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,720,598 (GRCm39) missense unknown
R0617:Cfap54 UTSW 10 92,665,512 (GRCm39) splice site probably benign
R0632:Cfap54 UTSW 10 92,720,958 (GRCm39) missense unknown
R0730:Cfap54 UTSW 10 92,870,599 (GRCm39) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,803,397 (GRCm39) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,706,531 (GRCm39) missense unknown
R1004:Cfap54 UTSW 10 92,902,558 (GRCm39) splice site probably benign
R1033:Cfap54 UTSW 10 92,675,311 (GRCm39) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,773,782 (GRCm39) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,711,856 (GRCm39) missense unknown
R1429:Cfap54 UTSW 10 92,656,900 (GRCm39) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,768,583 (GRCm39) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,820,089 (GRCm39) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,768,502 (GRCm39) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 92,871,304 (GRCm39) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 92,883,923 (GRCm39) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,798,237 (GRCm39) missense probably benign 0.35
R1889:Cfap54 UTSW 10 92,870,572 (GRCm39) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,720,564 (GRCm39) missense unknown
R1958:Cfap54 UTSW 10 92,833,204 (GRCm39) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,720,630 (GRCm39) missense unknown
R2018:Cfap54 UTSW 10 92,852,466 (GRCm39) missense probably benign 0.00
R2045:Cfap54 UTSW 10 92,874,671 (GRCm39) splice site probably null
R2059:Cfap54 UTSW 10 92,778,841 (GRCm39) unclassified probably benign
R2100:Cfap54 UTSW 10 92,837,799 (GRCm39) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,722,229 (GRCm39) missense unknown
R2392:Cfap54 UTSW 10 92,860,873 (GRCm39) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,833,236 (GRCm39) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,776,017 (GRCm39) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 92,881,144 (GRCm39) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3161:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,721,286 (GRCm39) missense unknown
R3730:Cfap54 UTSW 10 92,847,335 (GRCm39) nonsense probably null
R3770:Cfap54 UTSW 10 92,714,398 (GRCm39) missense unknown
R3776:Cfap54 UTSW 10 92,880,962 (GRCm39) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,740,206 (GRCm39) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,778,735 (GRCm39) unclassified probably benign
R3834:Cfap54 UTSW 10 92,636,985 (GRCm39) splice site probably benign
R3891:Cfap54 UTSW 10 92,874,708 (GRCm39) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,665,619 (GRCm39) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,720,885 (GRCm39) missense unknown
R4389:Cfap54 UTSW 10 92,803,362 (GRCm39) missense probably benign 0.37
R4542:Cfap54 UTSW 10 92,860,991 (GRCm39) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,675,402 (GRCm39) unclassified probably benign
R4576:Cfap54 UTSW 10 92,879,090 (GRCm39) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,805,619 (GRCm39) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,651,780 (GRCm39) missense probably benign 0.01
R4762:Cfap54 UTSW 10 92,897,315 (GRCm39) splice site probably null
R4776:Cfap54 UTSW 10 92,808,556 (GRCm39) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,672,339 (GRCm39) nonsense probably null
R4827:Cfap54 UTSW 10 92,737,937 (GRCm39) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,803,390 (GRCm39) missense probably benign 0.01
R4965:Cfap54 UTSW 10 92,902,661 (GRCm39) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,800,396 (GRCm39) missense probably benign 0.01
R5060:Cfap54 UTSW 10 92,875,013 (GRCm39) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 92,902,628 (GRCm39) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,773,636 (GRCm39) missense probably benign
R5094:Cfap54 UTSW 10 92,734,861 (GRCm39) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,773,753 (GRCm39) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,722,249 (GRCm39) splice site probably null
R5143:Cfap54 UTSW 10 92,865,020 (GRCm39) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,773,700 (GRCm39) missense probably benign 0.00
R5158:Cfap54 UTSW 10 92,901,059 (GRCm39) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92,880,885 (GRCm39) splice site probably null
R5256:Cfap54 UTSW 10 92,770,953 (GRCm39) nonsense probably null
R5266:Cfap54 UTSW 10 92,651,764 (GRCm39) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,656,968 (GRCm39) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 92,897,119 (GRCm39) intron probably benign
R5406:Cfap54 UTSW 10 92,837,720 (GRCm39) missense probably benign 0.33
R5471:Cfap54 UTSW 10 92,864,522 (GRCm39) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 92,864,979 (GRCm39) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,808,470 (GRCm39) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,808,473 (GRCm39) nonsense probably null
R5614:Cfap54 UTSW 10 92,880,911 (GRCm39) missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,814,879 (GRCm39) nonsense probably null
R5797:Cfap54 UTSW 10 92,803,438 (GRCm39) missense probably benign 0.11
R5859:Cfap54 UTSW 10 92,852,386 (GRCm39) nonsense probably null
R5878:Cfap54 UTSW 10 92,800,423 (GRCm39) missense probably benign 0.01
R5910:Cfap54 UTSW 10 92,901,043 (GRCm39) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R5994:Cfap54 UTSW 10 92,874,943 (GRCm39) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 92,881,197 (GRCm39) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 92,874,771 (GRCm39) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 92,902,708 (GRCm39) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,803,354 (GRCm39) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,672,319 (GRCm39) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,651,820 (GRCm39) missense unknown
R6597:Cfap54 UTSW 10 92,834,902 (GRCm39) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6720:Cfap54 UTSW 10 92,656,981 (GRCm39) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,710,877 (GRCm39) missense unknown
R6910:Cfap54 UTSW 10 92,672,374 (GRCm39) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,830,540 (GRCm39) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,710,881 (GRCm39) missense unknown
R7129:Cfap54 UTSW 10 92,852,433 (GRCm39) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,656,966 (GRCm39) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,612,072 (GRCm39) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,773,590 (GRCm39) missense unknown
R7225:Cfap54 UTSW 10 92,740,236 (GRCm39) missense unknown
R7270:Cfap54 UTSW 10 92,675,320 (GRCm39) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,637,000 (GRCm39) missense probably benign 0.00
R7380:Cfap54 UTSW 10 92,883,840 (GRCm39) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,720,565 (GRCm39) missense unknown
R7411:Cfap54 UTSW 10 92,704,617 (GRCm39) missense unknown
R7503:Cfap54 UTSW 10 92,723,298 (GRCm39) splice site probably null
R7622:Cfap54 UTSW 10 92,792,806 (GRCm39) missense unknown
R7679:Cfap54 UTSW 10 92,803,374 (GRCm39) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,704,603 (GRCm39) missense unknown
R7844:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R7980:Cfap54 UTSW 10 92,817,922 (GRCm39) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,737,941 (GRCm39) missense unknown
R8101:Cfap54 UTSW 10 92,720,658 (GRCm39) missense unknown
R8119:Cfap54 UTSW 10 92,704,672 (GRCm39) missense unknown
R8134:Cfap54 UTSW 10 92,714,378 (GRCm39) missense unknown
R8168:Cfap54 UTSW 10 92,744,739 (GRCm39) missense unknown
R8179:Cfap54 UTSW 10 92,833,178 (GRCm39) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,798,279 (GRCm39) missense unknown
R8436:Cfap54 UTSW 10 92,800,398 (GRCm39) missense unknown
R8505:Cfap54 UTSW 10 92,814,855 (GRCm39) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,790,934 (GRCm39) missense unknown
R8716:Cfap54 UTSW 10 92,800,494 (GRCm39) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,714,454 (GRCm39) missense unknown
R8822:Cfap54 UTSW 10 92,875,003 (GRCm39) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,774,110 (GRCm39) missense unknown
R8920:Cfap54 UTSW 10 92,776,199 (GRCm39) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 92,837,685 (GRCm39) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 92,879,255 (GRCm39) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 92,864,562 (GRCm39) nonsense probably null
R9010:Cfap54 UTSW 10 92,734,921 (GRCm39) missense unknown
R9017:Cfap54 UTSW 10 92,651,883 (GRCm39) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,651,770 (GRCm39) missense probably benign 0.03
R9095:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,820,097 (GRCm39) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,830,579 (GRCm39) missense probably benign 0.10
R9196:Cfap54 UTSW 10 92,873,753 (GRCm39) missense probably benign 0.22
R9203:Cfap54 UTSW 10 92,880,990 (GRCm39) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,770,960 (GRCm39) missense unknown
R9275:Cfap54 UTSW 10 92,875,048 (GRCm39) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,805,565 (GRCm39) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,656,936 (GRCm39) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,798,177 (GRCm39) missense unknown
R9397:Cfap54 UTSW 10 92,833,147 (GRCm39) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R9697:Cfap54 UTSW 10 92,792,851 (GRCm39) missense unknown
R9746:Cfap54 UTSW 10 92,637,081 (GRCm39) missense probably benign 0.03
R9755:Cfap54 UTSW 10 92,757,230 (GRCm39) missense unknown
X0022:Cfap54 UTSW 10 92,768,476 (GRCm39) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,714,465 (GRCm39) missense unknown
X0027:Cfap54 UTSW 10 92,837,750 (GRCm39) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,714,400 (GRCm39) missense unknown
Z1177:Cfap54 UTSW 10 92,814,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTATCAAGTTGTGGCAAC -3'
(R):5'- TGAAGGAGCTATGTGATGACCCC -3'

Sequencing Primer
(F):5'- AACTGACCCTAGGTAGAGCTCTG -3'
(R):5'- TGCCACAGTGAGGACCAGATTC -3'
Posted On 2018-07-24