Incidental Mutation 'R6703:Olfr727'
ID528305
Institutional Source Beutler Lab
Gene Symbol Olfr727
Ensembl Gene ENSMUSG00000059488
Gene Nameolfactory receptor 727
SynonymsGA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50123186-50128746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50127231 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 218 (Y218C)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
Predicted Effect probably damaging
Transcript: ENSMUST00000079142
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215317
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2655 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
E4f1 C A 17: 24,447,131 R231L probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in Olfr727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Olfr727 APN 14 50126757 missense probably damaging 1.00
IGL01306:Olfr727 APN 14 50126582 missense probably benign 0.00
ANU23:Olfr727 UTSW 14 50126582 missense probably benign 0.00
R0498:Olfr727 UTSW 14 50127293 missense probably damaging 1.00
R0574:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R1201:Olfr727 UTSW 14 50127356 missense probably damaging 1.00
R2112:Olfr727 UTSW 14 50126623 missense probably damaging 1.00
R2435:Olfr727 UTSW 14 50126754 missense probably damaging 1.00
R4238:Olfr727 UTSW 14 50127432 missense probably benign
R4611:Olfr727 UTSW 14 50127073 missense probably benign 0.12
R4663:Olfr727 UTSW 14 50127482 missense probably benign 0.00
R4672:Olfr727 UTSW 14 50127257 missense probably benign 0.02
R5022:Olfr727 UTSW 14 50127012 missense possibly damaging 0.78
R5062:Olfr727 UTSW 14 50127437 missense probably damaging 1.00
R5924:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R6702:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R7497:Olfr727 UTSW 14 50127495 missense probably benign 0.20
R7615:Olfr727 UTSW 14 50126989 missense probably benign 0.07
R7798:Olfr727 UTSW 14 50127438 missense probably damaging 1.00
R8413:Olfr727 UTSW 14 50127370 missense probably benign 0.19
R8439:Olfr727 UTSW 14 50127147 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCCGTGTATGTATCATTCTCG -3'
(R):5'- TGTAGAACACAGCAAGGACTTTG -3'

Sequencing Primer
(F):5'- ACTAGTCAGTTGGCATTCACTG -3'
(R):5'- CAGCAAGGACTTTGTCAACTG -3'
Posted On2018-07-24