Incidental Mutation 'R6703:E4f1'
ID528315
Institutional Source Beutler Lab
Gene Symbol E4f1
Ensembl Gene ENSMUSG00000024137
Gene NameE4F transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6703 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24443778-24470313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24447131 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 231 (R231L)
Ref Sequence ENSEMBL: ENSMUSP00000154444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056032] [ENSMUST00000088506] [ENSMUST00000119932] [ENSMUST00000148820] [ENSMUST00000154675] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably damaging
Transcript: ENSMUST00000056032
AA Change: R231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137
AA Change: R231L

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088506
SMART Domains Protein: ENSMUSP00000085862
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119932
SMART Domains Protein: ENSMUSP00000113508
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129401
Predicted Effect probably benign
Transcript: ENSMUST00000148820
SMART Domains Protein: ENSMUSP00000119453
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
Blast:DNaseIc 5 60 2e-33 BLAST
PDB:4AWN|A 22 60 5e-8 PDB
SCOP:d2dnja_ 22 60 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153858
Predicted Effect probably benign
Transcript: ENSMUST00000154675
SMART Domains Protein: ENSMUSP00000116743
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 1 180 4.58e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226654
AA Change: R72L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226754
AA Change: R231L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226941
AA Change: R231L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227293
Predicted Effect unknown
Transcript: ENSMUST00000228882
AA Change: R153L
Meta Mutation Damage Score 0.3078 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display early embryonic lethality with mitotic progression failure and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
1700080E11Rik T C 9: 105,144,559 Y96C possibly damaging Het
Akap13 T C 7: 75,602,898 S259P probably damaging Het
Aoc1 A C 6: 48,905,714 T197P probably damaging Het
Blnk A T 19: 40,962,506 probably null Het
Ccser1 A T 6: 61,638,511 K94* probably null Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Clec4n A G 6: 123,235,594 Q89R probably null Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Col6a3 C T 1: 90,792,462 R1552Q probably benign Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Dock7 T C 4: 98,946,672 E1822G probably damaging Het
Dpyd A T 3: 118,897,200 probably null Het
Dyrk4 A T 6: 126,890,082 I329N probably damaging Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Fkbp7 A T 2: 76,671,762 M99K probably damaging Het
Flad1 T C 3: 89,408,590 S222G probably benign Het
H1fnt C A 15: 98,257,272 probably benign Het
Ighg2b T C 12: 113,305,033 probably benign Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itln1 C T 1: 171,530,583 C199Y probably damaging Het
Kctd3 G A 1: 188,996,529 R137C probably damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp7 C T 3: 127,544,224 M395I probably damaging Het
Lpcat3 C T 6: 124,663,222 A5V probably benign Het
Lrrc43 C T 5: 123,499,469 T233M possibly damaging Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Mgst2 T C 3: 51,664,612 probably null Het
Mug2 T G 6: 122,078,694 I1112R probably benign Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nectin3 A G 16: 46,463,842 S160P probably damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr165 T C 16: 19,407,372 I215V probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdh10 G A 3: 45,381,299 V683M possibly damaging Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pif1 T C 9: 65,593,263 V490A probably damaging Het
Plekhn1 A T 4: 156,224,793 Y219N probably benign Het
Ppl T G 16: 5,089,464 E989A probably damaging Het
Prkdc T G 16: 15,670,528 S505A probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Ptges A G 2: 30,903,121 V33A possibly damaging Het
Qser1 G A 2: 104,777,325 T1416I possibly damaging Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rtn3 A T 19: 7,435,045 V788D probably damaging Het
Rtn4r T C 16: 18,151,191 L161P probably damaging Het
Rtn4rl1 G A 11: 75,265,528 R262Q probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Senp6 A G 9: 80,121,921 E522G probably damaging Het
Slc27a6 A G 18: 58,609,839 N533S probably benign Het
Slc39a5 T A 10: 128,397,782 D282V probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx14 A G 9: 88,422,914 I109T probably damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
Sox5 G T 6: 143,833,465 S648R probably damaging Het
Sptbn2 G A 19: 4,749,814 S2161N probably benign Het
Sptbn2 C A 19: 4,749,815 S2161R probably benign Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Tmub1 T C 5: 24,446,946 S7G probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Tusc5 A T 11: 76,694,162 probably null Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp438 A G 18: 5,214,044 S305P probably benign Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Other mutations in E4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:E4f1 APN 17 24444234 missense probably damaging 0.99
IGL02306:E4f1 APN 17 24446929 missense probably damaging 1.00
IGL03219:E4f1 APN 17 24445445 critical splice donor site probably null
FR4342:E4f1 UTSW 17 24455197 unclassified probably benign
FR4737:E4f1 UTSW 17 24455192 unclassified probably benign
R0084:E4f1 UTSW 17 24444082 missense possibly damaging 0.79
R0179:E4f1 UTSW 17 24451437 missense possibly damaging 0.57
R1171:E4f1 UTSW 17 24451549 missense probably damaging 1.00
R1773:E4f1 UTSW 17 24446584 missense probably damaging 1.00
R4531:E4f1 UTSW 17 24445987 missense possibly damaging 0.56
R5243:E4f1 UTSW 17 24447318 missense probably damaging 1.00
R5430:E4f1 UTSW 17 24444970 missense probably damaging 1.00
R5543:E4f1 UTSW 17 24447362 missense possibly damaging 0.49
R5598:E4f1 UTSW 17 24447129 missense probably damaging 1.00
R5604:E4f1 UTSW 17 24444144 missense probably damaging 1.00
R5858:E4f1 UTSW 17 24445328 missense probably damaging 1.00
R6240:E4f1 UTSW 17 24444582 missense possibly damaging 0.54
R7108:E4f1 UTSW 17 24444578 missense probably damaging 0.96
R7122:E4f1 UTSW 17 24444834 nonsense probably null
R7240:E4f1 UTSW 17 24444325 missense probably damaging 1.00
R7604:E4f1 UTSW 17 24455233 missense unknown
R7648:E4f1 UTSW 17 24445448 missense probably benign 0.02
RF002:E4f1 UTSW 17 24455186 unclassified probably benign
RF011:E4f1 UTSW 17 24455186 unclassified probably benign
RF020:E4f1 UTSW 17 24455195 unclassified probably benign
RF023:E4f1 UTSW 17 24455183 unclassified probably benign
RF028:E4f1 UTSW 17 24455190 unclassified probably benign
RF033:E4f1 UTSW 17 24455183 unclassified probably benign
RF035:E4f1 UTSW 17 24455190 unclassified probably benign
RF035:E4f1 UTSW 17 24455195 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGTAGAGAGAACAGTCAGCC -3'
(R):5'- CGCTACGTGTGCATGCTATG -3'

Sequencing Primer
(F):5'- AGAACAGTCAGCCCCGGG -3'
(R):5'- GTGTGCATGCTATGTCACAAGACC -3'
Posted On2018-07-24