Incidental Mutation 'R6734:Stk11ip'
ID528323
Institutional Source Beutler Lab
Gene Symbol Stk11ip
Ensembl Gene ENSMUSG00000026213
Gene Nameserine/threonine kinase 11 interacting protein
Synonyms1200014D22Rik, LKB1IP, LIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75521529-75537335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75532369 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 714 (V714A)
Ref Sequence ENSEMBL: ENSMUSP00000109182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027414] [ENSMUST00000113553]
Predicted Effect probably benign
Transcript: ENSMUST00000027414
AA Change: V714A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027414
Gene: ENSMUSG00000026213
AA Change: V714A

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
SCOP:d1h6ua2 74 291 2e-19 SMART
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113553
AA Change: V714A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109182
Gene: ENSMUSG00000026213
AA Change: V714A

DomainStartEndE-ValueType
Pfam:LIP1 4 94 2.9e-45 PFAM
low complexity region 175 194 N/A INTRINSIC
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156838
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Stk11ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Stk11ip APN 1 75530266 missense probably damaging 1.00
IGL01776:Stk11ip APN 1 75527821 missense probably benign 0.02
IGL02752:Stk11ip APN 1 75524681 critical splice acceptor site probably null
IGL03132:Stk11ip APN 1 75536089 missense probably benign 0.00
IGL03188:Stk11ip APN 1 75534435 missense probably benign 0.00
R6768_Stk11ip_021 UTSW 1 75532635 missense probably benign
sienna UTSW 1 75527355 splice site probably null
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0617:Stk11ip UTSW 1 75532288 splice site probably null
R0712:Stk11ip UTSW 1 75527447 missense probably damaging 0.99
R1672:Stk11ip UTSW 1 75528985 nonsense probably null
R1694:Stk11ip UTSW 1 75527386 missense probably damaging 1.00
R1891:Stk11ip UTSW 1 75532416 missense probably benign 0.08
R2061:Stk11ip UTSW 1 75529584 missense possibly damaging 0.94
R2094:Stk11ip UTSW 1 75525521 splice site probably benign
R2851:Stk11ip UTSW 1 75529267 splice site probably benign
R2852:Stk11ip UTSW 1 75529267 splice site probably benign
R4765:Stk11ip UTSW 1 75527155 missense probably damaging 1.00
R4775:Stk11ip UTSW 1 75533853 missense possibly damaging 0.95
R4785:Stk11ip UTSW 1 75530281 missense possibly damaging 0.95
R5002:Stk11ip UTSW 1 75532543 intron probably benign
R5524:Stk11ip UTSW 1 75532327 missense probably damaging 1.00
R5538:Stk11ip UTSW 1 75528335 missense probably damaging 1.00
R5849:Stk11ip UTSW 1 75527355 splice site probably null
R5927:Stk11ip UTSW 1 75524691 missense possibly damaging 0.93
R6053:Stk11ip UTSW 1 75534255 critical splice donor site probably null
R6485:Stk11ip UTSW 1 75529968 missense possibly damaging 0.47
R6768:Stk11ip UTSW 1 75532635 missense probably benign
R7070:Stk11ip UTSW 1 75527615 missense probably benign 0.39
R7882:Stk11ip UTSW 1 75529464 missense probably benign 0.03
R7965:Stk11ip UTSW 1 75529464 missense probably benign 0.03
X0066:Stk11ip UTSW 1 75534426 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACTATGCTTAGATATGGGTGAGG -3'
(R):5'- CCAAGCACGCTTCCACTTTG -3'

Sequencing Primer
(F):5'- ATGCTGCGAATGCTGGC -3'
(R):5'- GTTCCACCCATACTCACATGG -3'
Posted On2018-07-24