Mutagenetix > Incidental Mutations

Incidental Mutation 'R6734:Lrp4'

528324

Institutional Source

Beutler Lab

Gene Symbol

Lrp4

Ensembl Gene

ENSMUSG00000027253

Gene Name

low density lipoprotein receptor-related protein 4

Synonyms

mdig, Megf7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.699) question?

Stock #

R6734 (G1)

Quality Score

174.009

Status

Validated

Chromosome

Chromosomal Location

91457511-91513779 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 91485897 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 787 (V787M)

Ref Sequence

ENSEMBL: ENSMUSP00000028689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028689]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028689
AA Change: V787M

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028689
Gene: ENSMUSG00000027253
AA Change: V787M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LDLa	26	68	5.77e-10	SMART
LDLa	70	107	4.05e-14	SMART
LDLa	109	145	1.9e-10	SMART
LDLa	147	184	1.51e-13	SMART
LDLa	190	227	6.83e-12	SMART
LDLa	230	267	2.45e-13	SMART
LDLa	269	306	6.32e-16	SMART
LDLa	311	351	3.24e-13	SMART
EGF	357	394	1.4e0	SMART
EGF_CA	395	434	1.05e-8	SMART
LY	460	502	7.01e-10	SMART
LY	503	545	4.41e-16	SMART
LY	546	589	1.04e-12	SMART
LY	590	632	5.07e-16	SMART
LY	633	674	3.12e-7	SMART
EGF	701	737	9.27e-1	SMART
LY	765	807	7.29e-8	SMART
LY	808	850	1.92e-16	SMART
LY	851	894	3.05e-10	SMART
LY	895	937	6.69e-16	SMART
LY	938	979	8.71e-6	SMART
EGF	1005	1044	1.64e-1	SMART
LY	1073	1115	2.58e-8	SMART
LY	1116	1158	1.57e-12	SMART
LY	1159	1202	7.4e-9	SMART
LY	1203	1245	9.39e-11	SMART
LY	1246	1285	6.11e-1	SMART
EGF	1312	1349	1.53e-1	SMART
LY	1377	1419	4.42e-7	SMART
LY	1420	1462	1.04e-12	SMART
LY	1463	1506	2.11e-13	SMART
LY	1507	1549	4.66e-15	SMART
LY	1550	1590	2.02e-1	SMART
EGF_like	1616	1649	5.79e1	SMART
low complexity region	1674	1690	N/A	INTRINSIC
transmembrane domain	1724	1746	N/A	INTRINSIC
low complexity region	1857	1870	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations of this gene cause polysyndactyly. Additional phenotypes may include growth retardation, abnormal incisor development, kidney agenesis, and neonatal lethality associated with respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Ano6	A	G	15: 95,949,536	K554R	probably damaging	Het
Arhgef10	A	T	8: 14,975,053	I703F	probably damaging	Het
Bbs1	T	C	19: 4,903,896	S80G	probably benign	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Camk1	C	A	6: 113,334,384	R352L	probably benign	Het
Cand1	G	A	10: 119,211,992	P531L	possibly damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Col24a1	C	A	3: 145,508,674	P1384Q	probably benign	Het
Csmd2	C	A	4: 128,463,813	T1689K	probably benign	Het
Cyp26a1	T	A	19: 37,701,212	L452H	probably damaging	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dennd6a	G	T	14: 26,608,619	R115L	possibly damaging	Het
Eml2	T	A	7: 19,200,507	V377E	probably benign	Het
Fam135b	T	C	15: 71,462,780	E855G	probably benign	Het
Fam149a	A	T	8: 45,381,441	I107K	probably benign	Het
Fam227b	A	T	2: 126,126,976	Y59*	probably null	Het
Fbn2	T	C	18: 58,035,960	E2249G	probably damaging	Het
Flrt1	T	C	19: 7,096,159	D341G	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gm10334	T	C	6: 41,445,387	Y28C	probably damaging	Het
Gsdma2	A	G	11: 98,649,590	T112A	possibly damaging	Het
Klhl24	T	C	16: 20,107,529	V269A	probably damaging	Het
Lcorl	A	G	5: 45,733,497	S505P	probably damaging	Het
Liph	A	G	16: 21,983,957	S121P	probably damaging	Het
Lrrd1	A	C	5: 3,850,226	D177A	possibly damaging	Het
Mbd1	G	A	18: 74,276,043	R399H	probably damaging	Het
Naa25	C	T	5: 121,438,825	T879M	possibly damaging	Het
Naa35	T	G	13: 59,608,191	L147R	possibly damaging	Het
Ninl	C	A	2: 150,945,083		probably null	Het
Nrap	T	C	19: 56,345,509	D972G	probably damaging	Het
Olfr827	A	G	10: 130,210,257	F291S	probably benign	Het
Pdzd2	T	C	15: 12,592,465	E31G	probably damaging	Het
Plec	C	T	15: 76,194,403	E41K	probably damaging	Het
Plxnb1	A	T	9: 109,108,920	K1245*	probably null	Het
Ppfia1	T	C	7: 144,479,053	T1263A	probably damaging	Het
Prex2	G	A	1: 11,080,059	V152I	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prune2	T	G	19: 17,003,733	F85V	probably damaging	Het
Rrp1b	T	G	17: 32,055,304		probably benign	Het
Sec62	A	G	3: 30,810,460	T158A	probably benign	Het
Sema6a	G	A	18: 47,279,169	T526I	probably benign	Het
Shank1	G	T	7: 44,353,686	A1610S	probably benign	Het
Slc24a4	T	C	12: 102,219,000	V123A	probably damaging	Het
Stk11ip	T	C	1: 75,532,369	V714A	probably benign	Het
Tas1r3	T	C	4: 155,860,800	T655A	probably damaging	Het
Tns2	G	T	15: 102,103,116	L10F	probably damaging	Het
Trmt10c	A	G	16: 56,034,126	V382A	probably benign	Het
Unc45a	G	C	7: 80,336,998	T149R	probably damaging	Het
Zhx3	T	G	2: 160,781,720	I176L	probably damaging	Het
Zscan12	T	A	13: 21,368,796	C263*	probably null	Het

Other mutations in Lrp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Lrp4	APN	2	91495026	missense	probably benign
IGL00509:Lrp4	APN	2	91486174	splice site	probably benign
IGL01145:Lrp4	APN	2	91487051	missense	probably damaging	1.00
IGL01287:Lrp4	APN	2	91473948	missense	probably damaging	1.00
IGL01531:Lrp4	APN	2	91511553	missense	probably damaging	1.00
IGL01534:Lrp4	APN	2	91473641	missense	probably damaging	1.00
IGL01544:Lrp4	APN	2	91477551	missense	probably damaging	1.00
IGL01761:Lrp4	APN	2	91481981	critical splice donor site	probably null
IGL01885:Lrp4	APN	2	91501107	missense	probably benign	0.05
IGL01909:Lrp4	APN	2	91494184	missense	possibly damaging	0.50
IGL02111:Lrp4	APN	2	91506059	missense	probably damaging	1.00
IGL02385:Lrp4	APN	2	91474720	missense	possibly damaging	0.89
IGL02403:Lrp4	APN	2	91508582	missense	probably benign	0.05
IGL02431:Lrp4	APN	2	91476637	missense	possibly damaging	0.95
IGL02452:Lrp4	APN	2	91474002	missense	probably damaging	1.00
IGL02798:Lrp4	APN	2	91476710	missense	probably benign	0.02
IGL02828:Lrp4	APN	2	91475294	missense	probably benign
IGL02832:Lrp4	APN	2	91511580	missense	probably damaging	1.00
IGL02893:Lrp4	APN	2	91474816	missense	possibly damaging	0.76
F5770:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0037:Lrp4	UTSW	2	91471203	missense	probably benign	0.22
R0137:Lrp4	UTSW	2	91494982	missense	probably damaging	1.00
R0265:Lrp4	UTSW	2	91490670	missense	probably damaging	1.00
R0368:Lrp4	UTSW	2	91477734	missense	probably damaging	0.99
R0531:Lrp4	UTSW	2	91475178	splice site	probably benign
R0827:Lrp4	UTSW	2	91495041	missense	probably damaging	1.00
R1029:Lrp4	UTSW	2	91487027	splice site	probably benign
R1183:Lrp4	UTSW	2	91477519	critical splice acceptor site	probably null
R1587:Lrp4	UTSW	2	91476305	missense	probably benign	0.26
R1693:Lrp4	UTSW	2	91492353	missense	probably damaging	1.00
R1747:Lrp4	UTSW	2	91492621	missense	probably damaging	0.98
R1863:Lrp4	UTSW	2	91498363	missense	probably benign	0.15
R1908:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1909:Lrp4	UTSW	2	91498408	missense	possibly damaging	0.93
R1932:Lrp4	UTSW	2	91497355	nonsense	probably null
R1934:Lrp4	UTSW	2	91480432	missense	probably damaging	1.00
R2358:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R2433:Lrp4	UTSW	2	91506015	missense	probably benign	0.00
R2698:Lrp4	UTSW	2	91475212	missense	probably damaging	0.99
R2919:Lrp4	UTSW	2	91490730	missense	probably benign	0.01
R3105:Lrp4	UTSW	2	91501049	missense	probably benign
R3709:Lrp4	UTSW	2	91490466	missense	possibly damaging	0.60
R3711:Lrp4	UTSW	2	91501954	missense	probably benign	0.01
R3735:Lrp4	UTSW	2	91498371	missense	probably damaging	1.00
R3808:Lrp4	UTSW	2	91476702	missense	probably damaging	0.99
R3894:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R3895:Lrp4	UTSW	2	91473949	missense	probably damaging	1.00
R4397:Lrp4	UTSW	2	91511670	missense	probably benign	0.20
R4741:Lrp4	UTSW	2	91511567	missense	probably damaging	1.00
R4948:Lrp4	UTSW	2	91485886	missense	probably benign
R5050:Lrp4	UTSW	2	91492422	missense	probably benign	0.22
R5096:Lrp4	UTSW	2	91485792	missense	possibly damaging	0.65
R5110:Lrp4	UTSW	2	91497072	missense	possibly damaging	0.48
R5141:Lrp4	UTSW	2	91478678	splice site	probably benign
R5439:Lrp4	UTSW	2	91497073	missense	probably benign	0.14
R5725:Lrp4	UTSW	2	91494895	missense	probably damaging	1.00
R5795:Lrp4	UTSW	2	91474471	missense	probably benign	0.01
R5820:Lrp4	UTSW	2	91492615	missense	probably damaging	0.99
R5883:Lrp4	UTSW	2	91488433	missense	probably benign	0.01
R5919:Lrp4	UTSW	2	91473207	missense	probably damaging	1.00
R5925:Lrp4	UTSW	2	91511684	missense	probably benign	0.01
R6080:Lrp4	UTSW	2	91502000	missense	probably benign
R6189:Lrp4	UTSW	2	91475234	missense	possibly damaging	0.63
R6192:Lrp4	UTSW	2	91508488	missense	probably benign	0.00
R6319:Lrp4	UTSW	2	91480321	missense	probably damaging	1.00
R6378:Lrp4	UTSW	2	91493829	missense	probably benign	0.18
R6479:Lrp4	UTSW	2	91487084	missense	probably damaging	0.96
R6500:Lrp4	UTSW	2	91492420	missense	possibly damaging	0.90
R6643:Lrp4	UTSW	2	91501995	missense	probably benign
R6657:Lrp4	UTSW	2	91492053	missense	probably benign	0.00
R6696:Lrp4	UTSW	2	91497345	missense	probably benign	0.03
R6714:Lrp4	UTSW	2	91476365	missense	possibly damaging	0.90
R6770:Lrp4	UTSW	2	91497303	missense	probably benign	0.33
R6774:Lrp4	UTSW	2	91511504	missense	probably benign	0.01
R6957:Lrp4	UTSW	2	91487042	missense	probably damaging	0.99
R6978:Lrp4	UTSW	2	91491998	missense	probably damaging	1.00
R7065:Lrp4	UTSW	2	91511580	missense	probably damaging	1.00
R7142:Lrp4	UTSW	2	91494994	missense	probably damaging	0.99
R7219:Lrp4	UTSW	2	91492023	missense	probably damaging	1.00
R7237:Lrp4	UTSW	2	91473183	missense	probably benign	0.04
R7387:Lrp4	UTSW	2	91476614	missense	probably benign
R7585:Lrp4	UTSW	2	91492588	missense	probably damaging	1.00
R7835:Lrp4	UTSW	2	91495042	missense	possibly damaging	0.82
R7872:Lrp4	UTSW	2	91490716	missense	possibly damaging	0.54
R7968:Lrp4	UTSW	2	91494079	missense	possibly damaging	0.74
R8222:Lrp4	UTSW	2	91474741	missense	probably damaging	1.00
R8338:Lrp4	UTSW	2	91492368	missense	probably benign	0.15
R8342:Lrp4	UTSW	2	91488445	missense	probably damaging	1.00
R8435:Lrp4	UTSW	2	91477653	missense	probably damaging	1.00
R8720:Lrp4	UTSW	2	91494114	missense	probably damaging	1.00
R8774:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8774-TAIL:Lrp4	UTSW	2	91477698	missense	probably benign	0.09
R8792:Lrp4	UTSW	2	91494955	missense	possibly damaging	0.71
V7580:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7581:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7582:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
V7583:Lrp4	UTSW	2	91488518	missense	possibly damaging	0.96
X0021:Lrp4	UTSW	2	91501062	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TGAACCAGGTGTCACACAGG -3'
(R):5'- AGCAAAGTTTATCACTGTCTGC -3'

Sequencing Primer
(F):5'- CTGTCACCATTACTGGATTTAGAGC -3'
(R):5'- GCAAAGTTTATCACTGTCTGCACTCC -3'

Posted On

2018-07-24