Incidental Mutation 'R6734:Fam227b'
ID 528325
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 044852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6734 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 125825403-125993924 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 125968896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 59 (Y59*)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably null
Transcript: ENSMUST00000110446
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110448
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably null
Transcript: ENSMUST00000178118
AA Change: Y59*
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: Y59*

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Ano6 A G 15: 95,847,417 (GRCm39) K554R probably damaging Het
Arhgef10 A T 8: 15,025,053 (GRCm39) I703F probably damaging Het
Bbs1 T C 19: 4,953,924 (GRCm39) S80G probably benign Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Camk1 C A 6: 113,311,345 (GRCm39) R352L probably benign Het
Cand1 G A 10: 119,047,897 (GRCm39) P531L possibly damaging Het
Cnot2 G A 10: 116,334,058 (GRCm39) P371S possibly damaging Het
Col24a1 C A 3: 145,214,429 (GRCm39) P1384Q probably benign Het
Csmd2 C A 4: 128,357,606 (GRCm39) T1689K probably benign Het
Cyp26a1 T A 19: 37,689,660 (GRCm39) L452H probably damaging Het
Dcpp2 T C 17: 24,119,545 (GRCm39) Y120H probably damaging Het
Dennd6a G T 14: 26,329,774 (GRCm39) R115L possibly damaging Het
Eml2 T A 7: 18,934,432 (GRCm39) V377E probably benign Het
Fam135b T C 15: 71,334,629 (GRCm39) E855G probably benign Het
Fam149a A T 8: 45,834,478 (GRCm39) I107K probably benign Het
Fbn2 T C 18: 58,169,032 (GRCm39) E2249G probably damaging Het
Flrt1 T C 19: 7,073,524 (GRCm39) D341G possibly damaging Het
Galnt9 G A 5: 110,768,465 (GRCm39) R587H probably damaging Het
Gsdma2 A G 11: 98,540,416 (GRCm39) T112A possibly damaging Het
Klhl24 T C 16: 19,926,279 (GRCm39) V269A probably damaging Het
Lcorl A G 5: 45,890,839 (GRCm39) S505P probably damaging Het
Liph A G 16: 21,802,707 (GRCm39) S121P probably damaging Het
Lrp4 G A 2: 91,316,242 (GRCm39) V787M possibly damaging Het
Lrrd1 A C 5: 3,900,226 (GRCm39) D177A possibly damaging Het
Mbd1 G A 18: 74,409,114 (GRCm39) R399H probably damaging Het
Naa25 C T 5: 121,576,888 (GRCm39) T879M possibly damaging Het
Naa35 T G 13: 59,756,005 (GRCm39) L147R possibly damaging Het
Ninl C A 2: 150,787,003 (GRCm39) probably null Het
Nrap T C 19: 56,333,941 (GRCm39) D972G probably damaging Het
Or9k7 A G 10: 130,046,126 (GRCm39) F291S probably benign Het
Pdzd2 T C 15: 12,592,551 (GRCm39) E31G probably damaging Het
Plec C T 15: 76,078,603 (GRCm39) E41K probably damaging Het
Plxnb1 A T 9: 108,937,988 (GRCm39) K1245* probably null Het
Ppfia1 T C 7: 144,032,790 (GRCm39) T1263A probably damaging Het
Prex2 G A 1: 11,150,283 (GRCm39) V152I probably damaging Het
Prpf40b C T 15: 99,212,784 (GRCm39) R627W probably damaging Het
Prss3l T C 6: 41,422,321 (GRCm39) Y28C probably damaging Het
Prune2 T G 19: 16,981,097 (GRCm39) F85V probably damaging Het
Rrp1b T G 17: 32,274,278 (GRCm39) probably benign Het
Sec62 A G 3: 30,864,609 (GRCm39) T158A probably benign Het
Sema6a G A 18: 47,412,236 (GRCm39) T526I probably benign Het
Shank1 G T 7: 44,003,110 (GRCm39) A1610S probably benign Het
Slc24a4 T C 12: 102,185,259 (GRCm39) V123A probably damaging Het
Stk11ip T C 1: 75,509,013 (GRCm39) V714A probably benign Het
Tas1r3 T C 4: 155,945,257 (GRCm39) T655A probably damaging Het
Tns2 G T 15: 102,011,551 (GRCm39) L10F probably damaging Het
Trmt10c A G 16: 55,854,489 (GRCm39) V382A probably benign Het
Unc45a G C 7: 79,986,746 (GRCm39) T149R probably damaging Het
Zhx3 T G 2: 160,623,640 (GRCm39) I176L probably damaging Het
Zscan12 T A 13: 21,552,966 (GRCm39) C263* probably null Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 125,986,245 (GRCm39) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 125,968,980 (GRCm39) missense probably benign 0.01
IGL02040:Fam227b APN 2 125,963,004 (GRCm39) splice site probably benign
IGL02095:Fam227b APN 2 125,942,924 (GRCm39) missense probably damaging 0.97
IGL02352:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02359:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02506:Fam227b APN 2 125,845,831 (GRCm39) missense probably benign 0.22
IGL02717:Fam227b APN 2 125,845,763 (GRCm39) missense probably null 0.97
IGL02933:Fam227b APN 2 125,965,908 (GRCm39) splice site probably null
IGL03064:Fam227b APN 2 125,968,762 (GRCm39) splice site probably null
IGL03086:Fam227b APN 2 125,960,951 (GRCm39) missense probably benign 0.01
IGL03198:Fam227b APN 2 125,966,499 (GRCm39) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,830,923 (GRCm39) missense probably damaging 0.99
IGL03368:Fam227b APN 2 125,960,983 (GRCm39) missense probably damaging 1.00
dana UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0110:Fam227b UTSW 2 125,942,841 (GRCm39) missense probably damaging 1.00
R0140:Fam227b UTSW 2 125,966,523 (GRCm39) missense possibly damaging 0.53
R0377:Fam227b UTSW 2 125,966,920 (GRCm39) splice site probably benign
R0499:Fam227b UTSW 2 125,942,829 (GRCm39) missense probably benign 0.25
R1240:Fam227b UTSW 2 125,966,505 (GRCm39) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 125,960,928 (GRCm39) missense probably damaging 1.00
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R2055:Fam227b UTSW 2 125,942,874 (GRCm39) missense probably benign 0.13
R2884:Fam227b UTSW 2 125,942,846 (GRCm39) missense probably benign 0.01
R3124:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3125:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3937:Fam227b UTSW 2 125,968,980 (GRCm39) missense probably benign 0.01
R4408:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4455:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4457:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4558:Fam227b UTSW 2 125,968,963 (GRCm39) missense probably benign 0.00
R4661:Fam227b UTSW 2 125,849,230 (GRCm39) missense probably damaging 0.99
R4809:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125,829,859 (GRCm39) missense probably benign 0.01
R4989:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5011:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5013:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5014:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5133:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5184:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5431:Fam227b UTSW 2 125,968,851 (GRCm39) missense probably benign 0.09
R5797:Fam227b UTSW 2 125,849,254 (GRCm39) missense probably benign
R6056:Fam227b UTSW 2 125,962,972 (GRCm39) missense probably damaging 1.00
R6218:Fam227b UTSW 2 125,968,882 (GRCm39) missense probably damaging 1.00
R6471:Fam227b UTSW 2 125,962,985 (GRCm39) missense probably damaging 1.00
R6660:Fam227b UTSW 2 125,986,227 (GRCm39) missense probably damaging 1.00
R7136:Fam227b UTSW 2 125,965,948 (GRCm39) missense probably damaging 0.99
R7410:Fam227b UTSW 2 125,960,983 (GRCm39) missense probably damaging 1.00
R8417:Fam227b UTSW 2 125,962,982 (GRCm39) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,830,928 (GRCm39) missense probably benign 0.02
R8731:Fam227b UTSW 2 125,968,898 (GRCm39) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 125,958,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTATGAGAATACACATAGAGCAAGC -3'
(R):5'- GGTCCCCTAAGGCTTTTGATTATTC -3'

Sequencing Primer
(F):5'- TAGAGCAAGCATACATAGACAGAC -3'
(R):5'- TTATTGGCCCAGGGATGT -3'
Posted On 2018-07-24