Incidental Mutation 'R6734:Sec62'
ID528328
Institutional Source Beutler Lab
Gene Symbol Sec62
Ensembl Gene ENSMUSG00000027706
Gene NameSEC62 homolog (S. cerevisiae)
Synonyms3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30792875-30821263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30810460 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000029256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029256]
Predicted Effect probably benign
Transcript: ENSMUST00000029256
AA Change: T158A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: T158A

DomainStartEndE-ValueType
Pfam:Sec62 87 311 1.1e-78 PFAM
low complexity region 338 357 N/A INTRINSIC
low complexity region 376 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Sec62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Sec62 APN 3 30810442 splice site probably benign
IGL01359:Sec62 APN 3 30814306 missense unknown
IGL01746:Sec62 APN 3 30814246 missense probably benign 0.39
IGL02437:Sec62 APN 3 30818847 missense unknown
IGL03355:Sec62 APN 3 30809922 missense unknown
R2400:Sec62 UTSW 3 30810532 missense unknown
R4423:Sec62 UTSW 3 30814282 missense unknown
R4649:Sec62 UTSW 3 30810534 missense unknown
R4717:Sec62 UTSW 3 30809871 missense unknown
R4837:Sec62 UTSW 3 30809869 missense unknown
R5775:Sec62 UTSW 3 30793287 utr 5 prime probably benign
R6153:Sec62 UTSW 3 30810482 missense unknown
R6275:Sec62 UTSW 3 30809836 missense probably damaging 0.98
R7216:Sec62 UTSW 3 30818829 nonsense probably null
R7250:Sec62 UTSW 3 30812347 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- ATGTGCTCTTTATTGTCCTGTGC -3'
(R):5'- AGGAAACCTGTGTTGTACTAAGCT -3'

Sequencing Primer
(F):5'- GCTCTTTATTGTCCTGTGCTCATAAG -3'
(R):5'- CTCAAATGAAGTCAAATCTGATTC -3'
Posted On2018-07-24