Mutagenetix > Incidental Mutations

Incidental Mutation 'R6734:Sec62'

528328

Institutional Source

Beutler Lab

Gene Symbol

Sec62

Ensembl Gene

ENSMUSG00000027706

Gene Name

SEC62 homolog (S. cerevisiae)

Synonyms

3100002M17Rik, Dtrp1, Tloc1, HTP1, SEC62

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.864) question?

Stock #

R6734 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30792875-30821263 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30810460 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 158 (T158A)

Ref Sequence

ENSEMBL: ENSMUSP00000029256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029256]

Predicted Effect

probably benign
Transcript: ENSMUST00000029256
AA Change: T158A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000029256
Gene: ENSMUSG00000027706
AA Change: T158A

Domain	Start	End	E-Value	Type
Pfam:Sec62	87	311	1.1e-78	PFAM
low complexity region	338	357	N/A	INTRINSIC
low complexity region	376	389	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC63 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Ano6	A	G	15: 95,949,536	K554R	probably damaging	Het
Arhgef10	A	T	8: 14,975,053	I703F	probably damaging	Het
Bbs1	T	C	19: 4,903,896	S80G	probably benign	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Camk1	C	A	6: 113,334,384	R352L	probably benign	Het
Cand1	G	A	10: 119,211,992	P531L	possibly damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Col24a1	C	A	3: 145,508,674	P1384Q	probably benign	Het
Csmd2	C	A	4: 128,463,813	T1689K	probably benign	Het
Cyp26a1	T	A	19: 37,701,212	L452H	probably damaging	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dennd6a	G	T	14: 26,608,619	R115L	possibly damaging	Het
Eml2	T	A	7: 19,200,507	V377E	probably benign	Het
Fam135b	T	C	15: 71,462,780	E855G	probably benign	Het
Fam149a	A	T	8: 45,381,441	I107K	probably benign	Het
Fam227b	A	T	2: 126,126,976	Y59*	probably null	Het
Fbn2	T	C	18: 58,035,960	E2249G	probably damaging	Het
Flrt1	T	C	19: 7,096,159	D341G	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gm10334	T	C	6: 41,445,387	Y28C	probably damaging	Het
Gsdma2	A	G	11: 98,649,590	T112A	possibly damaging	Het
Klhl24	T	C	16: 20,107,529	V269A	probably damaging	Het
Lcorl	A	G	5: 45,733,497	S505P	probably damaging	Het
Liph	A	G	16: 21,983,957	S121P	probably damaging	Het
Lrp4	G	A	2: 91,485,897	V787M	possibly damaging	Het
Lrrd1	A	C	5: 3,850,226	D177A	possibly damaging	Het
Mbd1	G	A	18: 74,276,043	R399H	probably damaging	Het
Naa25	C	T	5: 121,438,825	T879M	possibly damaging	Het
Naa35	T	G	13: 59,608,191	L147R	possibly damaging	Het
Ninl	C	A	2: 150,945,083		probably null	Het
Nrap	T	C	19: 56,345,509	D972G	probably damaging	Het
Olfr827	A	G	10: 130,210,257	F291S	probably benign	Het
Pdzd2	T	C	15: 12,592,465	E31G	probably damaging	Het
Plec	C	T	15: 76,194,403	E41K	probably damaging	Het
Plxnb1	A	T	9: 109,108,920	K1245*	probably null	Het
Ppfia1	T	C	7: 144,479,053	T1263A	probably damaging	Het
Prex2	G	A	1: 11,080,059	V152I	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prune2	T	G	19: 17,003,733	F85V	probably damaging	Het
Rrp1b	T	G	17: 32,055,304		probably benign	Het
Sema6a	G	A	18: 47,279,169	T526I	probably benign	Het
Shank1	G	T	7: 44,353,686	A1610S	probably benign	Het
Slc24a4	T	C	12: 102,219,000	V123A	probably damaging	Het
Stk11ip	T	C	1: 75,532,369	V714A	probably benign	Het
Tas1r3	T	C	4: 155,860,800	T655A	probably damaging	Het
Tns2	G	T	15: 102,103,116	L10F	probably damaging	Het
Trmt10c	A	G	16: 56,034,126	V382A	probably benign	Het
Unc45a	G	C	7: 80,336,998	T149R	probably damaging	Het
Zhx3	T	G	2: 160,781,720	I176L	probably damaging	Het
Zscan12	T	A	13: 21,368,796	C263*	probably null	Het

Other mutations in Sec62

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Sec62	APN	3	30810442	splice site	probably benign
IGL01359:Sec62	APN	3	30814306	missense	unknown
IGL01746:Sec62	APN	3	30814246	missense	probably benign	0.39
IGL02437:Sec62	APN	3	30818847	missense	unknown
IGL03355:Sec62	APN	3	30809922	missense	unknown
R2400:Sec62	UTSW	3	30810532	missense	unknown
R4423:Sec62	UTSW	3	30814282	missense	unknown
R4649:Sec62	UTSW	3	30810534	missense	unknown
R4717:Sec62	UTSW	3	30809871	missense	unknown
R4837:Sec62	UTSW	3	30809869	missense	unknown
R5775:Sec62	UTSW	3	30793287	utr 5 prime	probably benign
R6153:Sec62	UTSW	3	30810482	missense	unknown
R6275:Sec62	UTSW	3	30809836	missense	probably damaging	0.98
R7216:Sec62	UTSW	3	30818829	nonsense	probably null
R7250:Sec62	UTSW	3	30812347	missense	possibly damaging	0.57
R7453:Sec62	UTSW	3	30809796	splice site	probably null
R8411:Sec62	UTSW	3	30818782	missense	unknown
R8537:Sec62	UTSW	3	30818812	missense	unknown
R8769:Sec62	UTSW	3	30810028	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGTGCTCTTTATTGTCCTGTGC -3'
(R):5'- AGGAAACCTGTGTTGTACTAAGCT -3'

Sequencing Primer
(F):5'- GCTCTTTATTGTCCTGTGCTCATAAG -3'
(R):5'- CTCAAATGAAGTCAAATCTGATTC -3'

Posted On

2018-07-24