Incidental Mutation 'R6734:Acot11'
ID528330
Institutional Source Beutler Lab
Gene Symbol Acot11
Ensembl Gene ENSMUSG00000034853
Gene Nameacyl-CoA thioesterase 11
SynonymsThea, Them1, 2010309H15Rik, 1110020M10Rik, BFIT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106744555-106804998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106760130 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 240 (G240R)
Ref Sequence ENSEMBL: ENSMUSP00000099823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541] [ENSMUST00000145061] [ENSMUST00000148688] [ENSMUST00000156567]
Predicted Effect probably damaging
Transcript: ENSMUST00000065253
AA Change: G260R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853
AA Change: G260R

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102762
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853
AA Change: G240R

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144809
Predicted Effect probably benign
Transcript: ENSMUST00000145061
SMART Domains Protein: ENSMUSP00000125123
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 49 107 4.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148688
SMART Domains Protein: ENSMUSP00000124385
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 28 93 6e-23 PDB
SCOP:d1lo7a_ 33 93 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156567
SMART Domains Protein: ENSMUSP00000123942
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 43 89 8e-11 PDB
SCOP:d1lo7a_ 48 80 2e-3 SMART
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null mutation display resistance to high fat diet induced obesity, inflammation and hepatic steatosis, increased energy expenditure, increased brown adipose tissue amount, and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Acot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Acot11 APN 4 106771484 missense probably benign 0.00
IGL01896:Acot11 APN 4 106771367 missense probably damaging 1.00
IGL02408:Acot11 APN 4 106758381 missense probably damaging 1.00
IGL03053:Acot11 APN 4 106755853 nonsense probably null
IGL03156:Acot11 APN 4 106754136 missense probably damaging 1.00
R0266:Acot11 UTSW 4 106749988 missense probably damaging 0.99
R0485:Acot11 UTSW 4 106762027 missense probably damaging 1.00
R0537:Acot11 UTSW 4 106762455 missense probably benign 0.10
R0707:Acot11 UTSW 4 106760132 missense probably damaging 1.00
R0969:Acot11 UTSW 4 106760080 critical splice donor site probably null
R1109:Acot11 UTSW 4 106749348 missense probably benign 0.01
R1785:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1786:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1965:Acot11 UTSW 4 106749353 missense probably damaging 1.00
R2076:Acot11 UTSW 4 106770713 missense probably damaging 0.99
R2509:Acot11 UTSW 4 106755319 missense possibly damaging 0.90
R4558:Acot11 UTSW 4 106748366 missense probably damaging 1.00
R4565:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4567:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4847:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4881:Acot11 UTSW 4 106755305 critical splice donor site probably null
R5234:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5235:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5409:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5430:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5518:Acot11 UTSW 4 106750010 missense probably benign 0.24
R5763:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5787:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5788:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5933:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5934:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6093:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6104:Acot11 UTSW 4 106755897 missense probably damaging 1.00
R6726:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6727:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6728:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R7242:Acot11 UTSW 4 106762493 missense probably benign 0.00
R7257:Acot11 UTSW 4 106758402 missense probably damaging 1.00
R7360:Acot11 UTSW 4 106749351 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCCAGAGGTGTGGAAATCTAGG -3'
(R):5'- TGTCATTGTCCCAGGGCTTC -3'

Sequencing Primer
(F):5'- TAGGGTTCTCCTAGCAGAGCAC -3'
(R):5'- CCATGGACAGTCTATCCTTAGGG -3'
Posted On2018-07-24