Incidental Mutation 'R6734:Naa25'
ID528336
Institutional Source Beutler Lab
Gene Symbol Naa25
Ensembl Gene ENSMUSG00000042719
Gene NameN(alpha)-acetyltransferase 25, NatB auxiliary subunit
SynonymsC330023M02Rik, 4833422K13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121397936-121444378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121438825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 879 (T879M)
Ref Sequence ENSEMBL: ENSMUSP00000038977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042163] [ENSMUST00000130451] [ENSMUST00000151458] [ENSMUST00000153758] [ENSMUST00000173895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042163
AA Change: T879M

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038977
Gene: ENSMUSG00000042719
AA Change: T879M

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:NatB_MDM20 263 658 1.6e-121 PFAM
low complexity region 672 683 N/A INTRINSIC
low complexity region 687 700 N/A INTRINSIC
low complexity region 721 734 N/A INTRINSIC
low complexity region 915 935 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130451
SMART Domains Protein: ENSMUSP00000117347
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:ERp29_N 35 157 9.3e-61 PFAM
Pfam:ERp29 158 252 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151458
SMART Domains Protein: ENSMUSP00000120970
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
SCOP:d1a17__ 21 94 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153758
SMART Domains Protein: ENSMUSP00000122522
Gene: ENSMUSG00000029616

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
SCOP:d1g7ea_ 35 55 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172908
SMART Domains Protein: ENSMUSP00000134345
Gene: ENSMUSG00000042719

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174322
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Naa25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Naa25 APN 5 121439865 missense probably damaging 1.00
IGL02142:Naa25 APN 5 121426762 missense possibly damaging 0.52
IGL02541:Naa25 APN 5 121424531 missense possibly damaging 0.92
IGL02747:Naa25 APN 5 121414605 splice site probably benign
IGL03074:Naa25 APN 5 121408337 critical splice donor site probably null
IGL03119:Naa25 APN 5 121434978 missense probably null 1.00
IGL03218:Naa25 APN 5 121426070 missense probably damaging 1.00
R0003:Naa25 UTSW 5 121407184 intron probably benign
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0022:Naa25 UTSW 5 121417976 missense probably damaging 1.00
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0102:Naa25 UTSW 5 121435569 missense possibly damaging 0.69
R0399:Naa25 UTSW 5 121435490 missense probably benign 0.00
R0973:Naa25 UTSW 5 121438716 splice site probably benign
R1418:Naa25 UTSW 5 121423734 missense probably damaging 1.00
R1582:Naa25 UTSW 5 121434829 missense probably benign
R1793:Naa25 UTSW 5 121417415 missense possibly damaging 0.82
R1793:Naa25 UTSW 5 121420593 missense probably damaging 1.00
R1863:Naa25 UTSW 5 121435548 missense probably benign 0.00
R3160:Naa25 UTSW 5 121435072 splice site probably null
R3162:Naa25 UTSW 5 121435072 splice site probably null
R3721:Naa25 UTSW 5 121431556 missense probably benign
R3864:Naa25 UTSW 5 121409197 missense probably damaging 0.96
R4852:Naa25 UTSW 5 121430692 missense probably damaging 1.00
R5077:Naa25 UTSW 5 121424576 missense probably benign 0.02
R5602:Naa25 UTSW 5 121420495 missense probably benign 0.30
R5855:Naa25 UTSW 5 121423692 missense possibly damaging 0.94
R6464:Naa25 UTSW 5 121417961 missense probably damaging 1.00
R6750:Naa25 UTSW 5 121408309 missense probably damaging 1.00
R6767:Naa25 UTSW 5 121439865 missense probably damaging 1.00
R6856:Naa25 UTSW 5 121438804 missense probably damaging 1.00
R7145:Naa25 UTSW 5 121417489 critical splice donor site probably null
R7631:Naa25 UTSW 5 121438728 missense possibly damaging 0.92
R7701:Naa25 UTSW 5 121425979 missense probably benign
R7800:Naa25 UTSW 5 121424531 missense possibly damaging 0.92
R7804:Naa25 UTSW 5 121424589 missense probably benign 0.00
R7822:Naa25 UTSW 5 121407213 missense probably damaging 1.00
X0004:Naa25 UTSW 5 121413081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACTTTGTCTCTGGCTGC -3'
(R):5'- CAGCTGCCTTACATAGTGAGAC -3'

Sequencing Primer
(F):5'- GCTATGCAGATGCCTTAGTGTAAC -3'
(R):5'- GTGAGACTGTCTTAAAACCAGC -3'
Posted On2018-07-24