Incidental Mutation 'R6734:Bhlhe40'
ID 528339
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044852-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6734 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Ano6 A G 15: 95,847,417 (GRCm39) K554R probably damaging Het
Arhgef10 A T 8: 15,025,053 (GRCm39) I703F probably damaging Het
Bbs1 T C 19: 4,953,924 (GRCm39) S80G probably benign Het
Camk1 C A 6: 113,311,345 (GRCm39) R352L probably benign Het
Cand1 G A 10: 119,047,897 (GRCm39) P531L possibly damaging Het
Cnot2 G A 10: 116,334,058 (GRCm39) P371S possibly damaging Het
Col24a1 C A 3: 145,214,429 (GRCm39) P1384Q probably benign Het
Csmd2 C A 4: 128,357,606 (GRCm39) T1689K probably benign Het
Cyp26a1 T A 19: 37,689,660 (GRCm39) L452H probably damaging Het
Dcpp2 T C 17: 24,119,545 (GRCm39) Y120H probably damaging Het
Dennd6a G T 14: 26,329,774 (GRCm39) R115L possibly damaging Het
Eml2 T A 7: 18,934,432 (GRCm39) V377E probably benign Het
Fam135b T C 15: 71,334,629 (GRCm39) E855G probably benign Het
Fam149a A T 8: 45,834,478 (GRCm39) I107K probably benign Het
Fam227b A T 2: 125,968,896 (GRCm39) Y59* probably null Het
Fbn2 T C 18: 58,169,032 (GRCm39) E2249G probably damaging Het
Flrt1 T C 19: 7,073,524 (GRCm39) D341G possibly damaging Het
Galnt9 G A 5: 110,768,465 (GRCm39) R587H probably damaging Het
Gsdma2 A G 11: 98,540,416 (GRCm39) T112A possibly damaging Het
Klhl24 T C 16: 19,926,279 (GRCm39) V269A probably damaging Het
Lcorl A G 5: 45,890,839 (GRCm39) S505P probably damaging Het
Liph A G 16: 21,802,707 (GRCm39) S121P probably damaging Het
Lrp4 G A 2: 91,316,242 (GRCm39) V787M possibly damaging Het
Lrrd1 A C 5: 3,900,226 (GRCm39) D177A possibly damaging Het
Mbd1 G A 18: 74,409,114 (GRCm39) R399H probably damaging Het
Naa25 C T 5: 121,576,888 (GRCm39) T879M possibly damaging Het
Naa35 T G 13: 59,756,005 (GRCm39) L147R possibly damaging Het
Ninl C A 2: 150,787,003 (GRCm39) probably null Het
Nrap T C 19: 56,333,941 (GRCm39) D972G probably damaging Het
Or9k7 A G 10: 130,046,126 (GRCm39) F291S probably benign Het
Pdzd2 T C 15: 12,592,551 (GRCm39) E31G probably damaging Het
Plec C T 15: 76,078,603 (GRCm39) E41K probably damaging Het
Plxnb1 A T 9: 108,937,988 (GRCm39) K1245* probably null Het
Ppfia1 T C 7: 144,032,790 (GRCm39) T1263A probably damaging Het
Prex2 G A 1: 11,150,283 (GRCm39) V152I probably damaging Het
Prpf40b C T 15: 99,212,784 (GRCm39) R627W probably damaging Het
Prss3l T C 6: 41,422,321 (GRCm39) Y28C probably damaging Het
Prune2 T G 19: 16,981,097 (GRCm39) F85V probably damaging Het
Rrp1b T G 17: 32,274,278 (GRCm39) probably benign Het
Sec62 A G 3: 30,864,609 (GRCm39) T158A probably benign Het
Sema6a G A 18: 47,412,236 (GRCm39) T526I probably benign Het
Shank1 G T 7: 44,003,110 (GRCm39) A1610S probably benign Het
Slc24a4 T C 12: 102,185,259 (GRCm39) V123A probably damaging Het
Stk11ip T C 1: 75,509,013 (GRCm39) V714A probably benign Het
Tas1r3 T C 4: 155,945,257 (GRCm39) T655A probably damaging Het
Tns2 G T 15: 102,011,551 (GRCm39) L10F probably damaging Het
Trmt10c A G 16: 55,854,489 (GRCm39) V382A probably benign Het
Unc45a G C 7: 79,986,746 (GRCm39) T149R probably damaging Het
Zhx3 T G 2: 160,623,640 (GRCm39) I176L probably damaging Het
Zscan12 T A 13: 21,552,966 (GRCm39) C263* probably null Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6595:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTGAAATCTTCCCAGCTCG -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-07-24