Incidental Mutation 'R6734:Camk1'
ID528340
Institutional Source Beutler Lab
Gene Symbol Camk1
Ensembl Gene ENSMUSG00000030272
Gene Namecalcium/calmodulin-dependent protein kinase I
SynonymsD6Ertd263e, CaMKIalpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location113334124-113343984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113334384 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 352 (R352L)
Ref Sequence ENSEMBL: ENSMUSP00000032409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000032409] [ENSMUST00000136263] [ENSMUST00000155543] [ENSMUST00000204834]
Predicted Effect probably benign
Transcript: ENSMUST00000032406
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032409
AA Change: R352L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032409
Gene: ENSMUSG00000030272
AA Change: R352L

DomainStartEndE-ValueType
S_TKc 20 276 5.03e-111 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136263
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147945
SMART Domains Protein: ENSMUSP00000116265
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Blast:ENDO3c 7 75 7e-46 BLAST
PDB:1KO9|A 7 104 1e-55 PDB
SCOP:d1ko9a1 8 82 1e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153067
Predicted Effect probably benign
Transcript: ENSMUST00000155543
SMART Domains Protein: ENSMUSP00000117749
Gene: ENSMUSG00000030272

DomainStartEndE-ValueType
Pfam:Pkinase 8 162 1.4e-45 PFAM
Pfam:Pkinase_Tyr 9 162 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156512
Predicted Effect probably benign
Transcript: ENSMUST00000204834
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium/calmodulin-dependent protein kinase I is expressed in many tissues and is a component of a calmodulin-dependent protein kinase cascade. Calcium/calmodulin directly activates calcium/calmodulin-dependent protein kinase I by binding to the enzyme and indirectly promotes the phosphorylation and synergistic activation of the enzyme by calcium/calmodulin-dependent protein kinase I kinase. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Camk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Camk1 APN 6 113336211 missense probably benign 0.00
IGL01063:Camk1 APN 6 113338372 missense probably damaging 0.98
R0415:Camk1 UTSW 6 113341891 nonsense probably null
R0944:Camk1 UTSW 6 113338391 missense probably damaging 1.00
R2342:Camk1 UTSW 6 113341981 splice site probably benign
R5646:Camk1 UTSW 6 113339340 missense probably damaging 0.99
R6749:Camk1 UTSW 6 113334525 missense probably benign 0.02
R7015:Camk1 UTSW 6 113341926 missense probably benign
R7041:Camk1 UTSW 6 113339514 missense probably benign 0.03
R7355:Camk1 UTSW 6 113338346 missense probably damaging 1.00
R7575:Camk1 UTSW 6 113338364 missense probably damaging 1.00
R7686:Camk1 UTSW 6 113336197 missense probably damaging 1.00
R7748:Camk1 UTSW 6 113340328 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTTGTATGGAAAACGCAGTGAAG -3'
(R):5'- TGGTTCGGCACATGAGGAAG -3'

Sequencing Primer
(F):5'- TATGGAAAACGCAGTGAAGAGTGAG -3'
(R):5'- CACATGAGGAAGCTGCAGC -3'
Posted On2018-07-24