Mutagenetix > Incidental Mutations

Incidental Mutation 'R6734:Eml2'

528341

Institutional Source

Beutler Lab

Gene Symbol

Eml2

Ensembl Gene

ENSMUSG00000040811

Gene Name

echinoderm microtubule associated protein like 2

Synonyms

1600029N02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6734 (G1)

Quality Score

208.009

Status

Validated

Chromosome

Chromosomal Location

19176421-19206482 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19200507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 377 (V377E)

Ref Sequence

ENSEMBL: ENSMUSP00000115466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000148246]

AlphaFold

Q7TNG5

Predicted Effect

probably benign
Transcript: ENSMUST00000048502
AA Change: V396E

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: V396E

Domain	Start	End	E-Value	Type
Pfam:HELP	17	65	4.6e-14	PFAM
WD40	113	162	8.36e-2	SMART
WD40	165	210	9.21e0	SMART
WD40	213	252	7.99e-1	SMART
WD40	258	298	3.7e0	SMART
WD40	301	341	3.58e-1	SMART
WD40	385	424	5.52e-2	SMART
WD40	427	465	1.1e1	SMART
WD40	468	507	4.95e-4	SMART
WD40	514	553	4.62e-4	SMART
WD40	579	620	4.75e1	SMART
WD40	626	666	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117338
AA Change: V569E

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: V569E

Domain	Start	End	E-Value	Type
low complexity region	2	32	N/A	INTRINSIC
coiled coil region	59	106	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
Pfam:HELP	211	285	3.5e-29	PFAM
WD40	286	335	5.5e-4	SMART
WD40	338	383	5.8e-2	SMART
WD40	386	425	5.2e-3	SMART
WD40	431	471	2.4e-2	SMART
WD40	474	514	2.3e-3	SMART
WD40	558	597	3.6e-4	SMART
WD40	600	638	7.1e-2	SMART
WD40	641	680	3.1e-6	SMART
WD40	687	726	3.1e-6	SMART
WD40	752	793	3e-1	SMART
WD40	799	839	1.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000120595
AA Change: V377E

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: V377E

Domain	Start	End	E-Value	Type
WD40	94	154	2.48e0	SMART
WD40	157	196	7.99e-1	SMART
WD40	202	242	3.7e0	SMART
WD40	245	285	3.58e-1	SMART
WD40	329	368	5.52e-2	SMART
WD40	371	409	1.1e1	SMART
WD40	412	451	4.95e-4	SMART
WD40	458	497	4.62e-4	SMART
WD40	523	564	4.75e1	SMART
WD40	570	610	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148246
AA Change: V377E

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: V377E

Domain	Start	End	E-Value	Type
WD40	94	143	8.36e-2	SMART
WD40	146	191	9.21e0	SMART
WD40	194	233	7.99e-1	SMART
WD40	239	279	3.7e0	SMART
WD40	282	322	3.58e-1	SMART
WD40	366	405	5.52e-2	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (52/52)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Ano6	A	G	15: 95,949,536	K554R	probably damaging	Het
Arhgef10	A	T	8: 14,975,053	I703F	probably damaging	Het
Bbs1	T	C	19: 4,903,896	S80G	probably benign	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Camk1	C	A	6: 113,334,384	R352L	probably benign	Het
Cand1	G	A	10: 119,211,992	P531L	possibly damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Col24a1	C	A	3: 145,508,674	P1384Q	probably benign	Het
Csmd2	C	A	4: 128,463,813	T1689K	probably benign	Het
Cyp26a1	T	A	19: 37,701,212	L452H	probably damaging	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dennd6a	G	T	14: 26,608,619	R115L	possibly damaging	Het
Fam135b	T	C	15: 71,462,780	E855G	probably benign	Het
Fam149a	A	T	8: 45,381,441	I107K	probably benign	Het
Fam227b	A	T	2: 126,126,976	Y59*	probably null	Het
Fbn2	T	C	18: 58,035,960	E2249G	probably damaging	Het
Flrt1	T	C	19: 7,096,159	D341G	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gm10334	T	C	6: 41,445,387	Y28C	probably damaging	Het
Gsdma2	A	G	11: 98,649,590	T112A	possibly damaging	Het
Klhl24	T	C	16: 20,107,529	V269A	probably damaging	Het
Lcorl	A	G	5: 45,733,497	S505P	probably damaging	Het
Liph	A	G	16: 21,983,957	S121P	probably damaging	Het
Lrp4	G	A	2: 91,485,897	V787M	possibly damaging	Het
Lrrd1	A	C	5: 3,850,226	D177A	possibly damaging	Het
Mbd1	G	A	18: 74,276,043	R399H	probably damaging	Het
Naa25	C	T	5: 121,438,825	T879M	possibly damaging	Het
Naa35	T	G	13: 59,608,191	L147R	possibly damaging	Het
Ninl	C	A	2: 150,945,083		probably null	Het
Nrap	T	C	19: 56,345,509	D972G	probably damaging	Het
Olfr827	A	G	10: 130,210,257	F291S	probably benign	Het
Pdzd2	T	C	15: 12,592,465	E31G	probably damaging	Het
Plec	C	T	15: 76,194,403	E41K	probably damaging	Het
Plxnb1	A	T	9: 109,108,920	K1245*	probably null	Het
Ppfia1	T	C	7: 144,479,053	T1263A	probably damaging	Het
Prex2	G	A	1: 11,080,059	V152I	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prune2	T	G	19: 17,003,733	F85V	probably damaging	Het
Rrp1b	T	G	17: 32,055,304		probably benign	Het
Sec62	A	G	3: 30,810,460	T158A	probably benign	Het
Sema6a	G	A	18: 47,279,169	T526I	probably benign	Het
Shank1	G	T	7: 44,353,686	A1610S	probably benign	Het
Slc24a4	T	C	12: 102,219,000	V123A	probably damaging	Het
Stk11ip	T	C	1: 75,532,369	V714A	probably benign	Het
Tas1r3	T	C	4: 155,860,800	T655A	probably damaging	Het
Tns2	G	T	15: 102,103,116	L10F	probably damaging	Het
Trmt10c	A	G	16: 56,034,126	V382A	probably benign	Het
Unc45a	G	C	7: 80,336,998	T149R	probably damaging	Het
Zhx3	T	G	2: 160,781,720	I176L	probably damaging	Het
Zscan12	T	A	13: 21,368,796	C263*	probably null	Het

Other mutations in Eml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00690:Eml2	APN	7	19206143	missense	probably damaging	1.00
IGL00786:Eml2	APN	7	19202582	missense	probably damaging	1.00
IGL01084:Eml2	APN	7	19190738	nonsense	probably null
IGL01132:Eml2	APN	7	19200539	missense	probably damaging	1.00
IGL01678:Eml2	APN	7	19186122	missense	probably benign	0.38
IGL01800:Eml2	APN	7	19201197	intron	probably benign
IGL02517:Eml2	APN	7	19206130	missense	probably damaging	1.00
IGL02607:Eml2	APN	7	19206111	missense	probably damaging	1.00
IGL02676:Eml2	APN	7	19184921	nonsense	probably null
IGL03082:Eml2	APN	7	19201877	missense	probably damaging	1.00
puffery	UTSW	7	19201163	missense	probably damaging	1.00
R0628_Eml2_697	UTSW	7	19201554	splice site	probably benign
R0040:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R0135:Eml2	UTSW	7	19203952	missense	probably damaging	1.00
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0240:Eml2	UTSW	7	19184872	nonsense	probably null
R0362:Eml2	UTSW	7	19190806	splice site	probably null
R0387:Eml2	UTSW	7	19182259	splice site	probably null
R0432:Eml2	UTSW	7	19179531	nonsense	probably null
R0614:Eml2	UTSW	7	19202591	missense	probably damaging	1.00
R0628:Eml2	UTSW	7	19201554	splice site	probably benign
R1078:Eml2	UTSW	7	19179762	missense	probably benign	0.24
R1531:Eml2	UTSW	7	19196254	missense	probably damaging	1.00
R1856:Eml2	UTSW	7	19194061	missense	probably damaging	0.97
R1864:Eml2	UTSW	7	19201878	missense	probably damaging	1.00
R1937:Eml2	UTSW	7	19203964	missense	possibly damaging	0.68
R2032:Eml2	UTSW	7	19202555	missense	probably benign	0.03
R2185:Eml2	UTSW	7	19194028	missense	probably damaging	1.00
R2419:Eml2	UTSW	7	19176695	unclassified	probably benign
R3821:Eml2	UTSW	7	19202986	missense	possibly damaging	0.94
R4199:Eml2	UTSW	7	19179439	missense	probably benign	0.00
R4411:Eml2	UTSW	7	19182401	critical splice donor site	probably null
R4497:Eml2	UTSW	7	19179350	missense	probably damaging	1.00
R4885:Eml2	UTSW	7	19204010	missense	probably benign	0.05
R4912:Eml2	UTSW	7	19193999	splice site	probably null
R5028:Eml2	UTSW	7	19179447	critical splice donor site	probably null
R5192:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5196:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5373:Eml2	UTSW	7	19179263	missense	possibly damaging	0.92
R5718:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5719:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5720:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5727:Eml2	UTSW	7	19190760	missense	probably damaging	0.99
R5841:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5842:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5843:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R5844:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6014:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6015:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6017:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6073:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6075:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6126:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6128:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6129:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6189:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6190:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6258:Eml2	UTSW	7	19179364	splice site	probably null
R6273:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6289:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6376:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6378:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6381:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6384:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6394:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6435:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6436:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6437:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6476:Eml2	UTSW	7	19196311	missense	probably benign	0.26
R6550:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6551:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6552:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6554:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6572:Eml2	UTSW	7	19196614	missense	possibly damaging	0.48
R6598:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6599:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6704:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6705:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6709:Eml2	UTSW	7	19206211	makesense	probably null
R6730:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6742:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6769:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6770:Eml2	UTSW	7	19201163	missense	probably damaging	1.00
R6864:Eml2	UTSW	7	19196281	missense	probably damaging	0.99
R6878:Eml2	UTSW	7	19200612	missense	probably benign	0.08
R7045:Eml2	UTSW	7	19201579	missense	probably damaging	1.00
R7260:Eml2	UTSW	7	19200590	missense	probably benign	0.45
R7478:Eml2	UTSW	7	19206141	nonsense	probably null
R7706:Eml2	UTSW	7	19186110	missense	possibly damaging	0.79
R7811:Eml2	UTSW	7	19186122	missense	probably benign	0.38
R8084:Eml2	UTSW	7	19181224	critical splice donor site	probably null
R8337:Eml2	UTSW	7	19196236	missense	possibly damaging	0.84
R8414:Eml2	UTSW	7	19179295	missense	probably damaging	1.00
R8868:Eml2	UTSW	7	19194063	missense	probably benign	0.03
R8934:Eml2	UTSW	7	19179813	missense	probably damaging	0.99
R9110:Eml2	UTSW	7	19191695	missense	probably benign	0.07
R9131:Eml2	UTSW	7	19184826	missense
R9144:Eml2	UTSW	7	19201639	missense	possibly damaging	0.75
R9261:Eml2	UTSW	7	19179818	missense	probably benign	0.45
R9285:Eml2	UTSW	7	19191643	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTTCTTACTACTGTGCTCAGG -3'
(R):5'- GAAGCCATCCCCATTTCTTGG -3'

Sequencing Primer
(F):5'- acatacatgcccaggTG -3'
(R):5'- TCTCTCAGTCATGCCATAAGAGGG -3'

Posted On

2018-07-24