Incidental Mutation 'R6734:Unc45a'
ID528343
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 80336998 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 149 (T149R)
Ref Sequence ENSEMBL: ENSMUSP00000119665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428]
Predicted Effect probably damaging
Transcript: ENSMUST00000032748
AA Change: T149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: T149R

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107368
AA Change: T149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: T149R

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127997
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133728
AA Change: T134R
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533
AA Change: T134R

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably damaging
Transcript: ENSMUST00000154428
AA Change: T149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: T149R

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect unknown
Transcript: ENSMUST00000206363
AA Change: T83R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 intron probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGGACTCACAAGCTCCTTCC -3'
(R):5'- AGATGCCTGGCAAGTCTCTTC -3'

Sequencing Primer
(F):5'- TCCTACACAGGAGGCGTG -3'
(R):5'- CTGCCTGCCATGGTTGCTAG -3'
Posted On2018-07-24