Incidental Mutation 'R6734:Fam149a'
ID528346
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Namefamily with sequence similarity 149, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6734 (G1)
Quality Score172.009
Status Validated
Chromosome8
Chromosomal Location45336717-45382291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45381441 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 107 (I107K)
Ref Sequence ENSEMBL: ENSMUSP00000091245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526]
Predicted Effect probably benign
Transcript: ENSMUST00000093526
AA Change: I107K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: I107K

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45339343 missense probably damaging 1.00
IGL00229:Fam149a APN 8 45351786 missense probably damaging 0.98
IGL01089:Fam149a APN 8 45348527 missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45350442 missense probably damaging 1.00
IGL03095:Fam149a APN 8 45341228 missense probably damaging 1.00
IGL03112:Fam149a APN 8 45348543 missense possibly damaging 0.78
guangxi UTSW 8 45381741 missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45351706 missense probably benign 0.00
R0111:Fam149a UTSW 8 45341146 splice site probably benign
R0113:Fam149a UTSW 8 45341024 missense probably damaging 1.00
R0452:Fam149a UTSW 8 45355649 missense probably damaging 1.00
R0604:Fam149a UTSW 8 45345008 missense probably damaging 1.00
R1441:Fam149a UTSW 8 45355647 missense probably damaging 1.00
R1672:Fam149a UTSW 8 45339374 critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45339362 nonsense probably null
R1981:Fam149a UTSW 8 45381741 missense probably damaging 1.00
R2173:Fam149a UTSW 8 45353954 missense probably damaging 1.00
R2211:Fam149a UTSW 8 45341009 missense probably damaging 0.99
R3807:Fam149a UTSW 8 45381610 missense possibly damaging 0.91
R4176:Fam149a UTSW 8 45341284 missense probably benign 0.41
R4913:Fam149a UTSW 8 45353883 missense probably damaging 1.00
R5158:Fam149a UTSW 8 45350435 missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45344653 missense probably damaging 0.99
R5436:Fam149a UTSW 8 45348471 missense probably benign 0.21
R6060:Fam149a UTSW 8 45358762 intron probably benign
R6426:Fam149a UTSW 8 45381574 missense probably benign
R6590:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6596:Fam149a UTSW 8 45381630 missense probably benign 0.25
R6690:Fam149a UTSW 8 45349034 missense probably damaging 1.00
R6730:Fam149a UTSW 8 45381174 missense probably damaging 1.00
R6916:Fam149a UTSW 8 45350406 missense probably damaging 1.00
R7088:Fam149a UTSW 8 45350545 missense probably benign 0.08
R7219:Fam149a UTSW 8 45350563 missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45340997 missense probably damaging 0.98
R7454:Fam149a UTSW 8 45348546 missense probably benign 0.29
R7591:Fam149a UTSW 8 45350435 missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45381517 missense probably damaging 1.00
R7846:Fam149a UTSW 8 45358641 missense
R7929:Fam149a UTSW 8 45358641 missense
Predicted Primers PCR Primer
(F):5'- ATCCATACACTGGGCTCTCG -3'
(R):5'- GCCACAGGATCAGTAGACTC -3'

Sequencing Primer
(F):5'- ATACACTGGGCTCTCGCTCTC -3'
(R):5'- CTTAGAGAGGCTGAGACCCTGAC -3'
Posted On2018-07-24