Mutagenetix > Incidental Mutations

Incidental Mutation 'R6734:Plxnb1'

528347

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6734 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 109108920 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1245 (K1245*)

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072093]

Predicted Effect

probably null
Transcript: ENSMUST00000072093
AA Change: K1245*

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: K1245*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192117

Predicted Effect

probably benign
Transcript: ENSMUST00000192988

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195364

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Ano6	A	G	15: 95,949,536	K554R	probably damaging	Het
Arhgef10	A	T	8: 14,975,053	I703F	probably damaging	Het
Bbs1	T	C	19: 4,903,896	S80G	probably benign	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Camk1	C	A	6: 113,334,384	R352L	probably benign	Het
Cand1	G	A	10: 119,211,992	P531L	possibly damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Col24a1	C	A	3: 145,508,674	P1384Q	probably benign	Het
Csmd2	C	A	4: 128,463,813	T1689K	probably benign	Het
Cyp26a1	T	A	19: 37,701,212	L452H	probably damaging	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dennd6a	G	T	14: 26,608,619	R115L	possibly damaging	Het
Eml2	T	A	7: 19,200,507	V377E	probably benign	Het
Fam135b	T	C	15: 71,462,780	E855G	probably benign	Het
Fam149a	A	T	8: 45,381,441	I107K	probably benign	Het
Fam227b	A	T	2: 126,126,976	Y59*	probably null	Het
Fbn2	T	C	18: 58,035,960	E2249G	probably damaging	Het
Flrt1	T	C	19: 7,096,159	D341G	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gm10334	T	C	6: 41,445,387	Y28C	probably damaging	Het
Gsdma2	A	G	11: 98,649,590	T112A	possibly damaging	Het
Klhl24	T	C	16: 20,107,529	V269A	probably damaging	Het
Lcorl	A	G	5: 45,733,497	S505P	probably damaging	Het
Liph	A	G	16: 21,983,957	S121P	probably damaging	Het
Lrp4	G	A	2: 91,485,897	V787M	possibly damaging	Het
Lrrd1	A	C	5: 3,850,226	D177A	possibly damaging	Het
Mbd1	G	A	18: 74,276,043	R399H	probably damaging	Het
Naa25	C	T	5: 121,438,825	T879M	possibly damaging	Het
Naa35	T	G	13: 59,608,191	L147R	possibly damaging	Het
Ninl	C	A	2: 150,945,083		probably null	Het
Nrap	T	C	19: 56,345,509	D972G	probably damaging	Het
Olfr827	A	G	10: 130,210,257	F291S	probably benign	Het
Pdzd2	T	C	15: 12,592,465	E31G	probably damaging	Het
Plec	C	T	15: 76,194,403	E41K	probably damaging	Het
Ppfia1	T	C	7: 144,479,053	T1263A	probably damaging	Het
Prex2	G	A	1: 11,080,059	V152I	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prune2	T	G	19: 17,003,733	F85V	probably damaging	Het
Rrp1b	T	G	17: 32,055,304		probably benign	Het
Sec62	A	G	3: 30,810,460	T158A	probably benign	Het
Sema6a	G	A	18: 47,279,169	T526I	probably benign	Het
Shank1	G	T	7: 44,353,686	A1610S	probably benign	Het
Slc24a4	T	C	12: 102,219,000	V123A	probably damaging	Het
Stk11ip	T	C	1: 75,532,369	V714A	probably benign	Het
Tas1r3	T	C	4: 155,860,800	T655A	probably damaging	Het
Tns2	G	T	15: 102,103,116	L10F	probably damaging	Het
Trmt10c	A	G	16: 56,034,126	V382A	probably benign	Het
Unc45a	G	C	7: 80,336,998	T149R	probably damaging	Het
Zhx3	T	G	2: 160,781,720	I176L	probably damaging	Het
Zscan12	T	A	13: 21,368,796	C263*	probably null	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R1936:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2422:Plxnb1	UTSW	9	109108438	missense	probably benign	0.02
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4796:Plxnb1	UTSW	9	109114595	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5431:Plxnb1	UTSW	9	109100772	missense	probably damaging	1.00
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6020:Plxnb1	UTSW	9	109116611	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TACACAGCGGAGACTTCAGTG -3'
(R):5'- CCTCAAATTGGTTCATTCATGACC -3'

Sequencing Primer
(F):5'- CCTAAGTGAGCCAAGATTTGAGTG -3'
(R):5'- CCCATTCTGTCAACAGTAAGGAGTTC -3'

Posted On

2018-07-24