Incidental Mutation 'R6734:Olfr827'
ID528350
Institutional Source Beutler Lab
Gene Symbol Olfr827
Ensembl Gene ENSMUSG00000045559
Gene Nameolfactory receptor 827
SynonymsMOR210-5, GA_x6K02T2PULF-11878777-11877809
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130203049-130214403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130210257 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 291 (F291S)
Ref Sequence ENSEMBL: ENSMUSP00000149200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058123] [ENSMUST00000213568]
Predicted Effect probably benign
Transcript: ENSMUST00000058123
AA Change: F291S

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000089609
Gene: ENSMUSG00000045559
AA Change: F291S

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 6e-53 PFAM
Pfam:7tm_1 53 300 2.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213568
AA Change: F291S

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216253
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Olfr827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Olfr827 APN 10 130210734 missense probably damaging 1.00
IGL02358:Olfr827 APN 10 130210734 missense probably damaging 1.00
R0179:Olfr827 UTSW 10 130210338 missense probably damaging 1.00
R0401:Olfr827 UTSW 10 130210620 missense probably damaging 1.00
R0607:Olfr827 UTSW 10 130211070 missense probably benign 0.33
R1139:Olfr827 UTSW 10 130211079 missense possibly damaging 0.53
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1462:Olfr827 UTSW 10 130210723 missense probably benign 0.30
R1645:Olfr827 UTSW 10 130210212 missense probably damaging 0.99
R4712:Olfr827 UTSW 10 130210422 missense possibly damaging 0.78
R4966:Olfr827 UTSW 10 130210437 missense probably benign 0.31
R5219:Olfr827 UTSW 10 130210924 missense possibly damaging 0.84
R6363:Olfr827 UTSW 10 130211037 missense possibly damaging 0.93
R6909:Olfr827 UTSW 10 130210753 missense probably benign
R7180:Olfr827 UTSW 10 130210942 missense probably benign 0.05
R7549:Olfr827 UTSW 10 130210984 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTGTAAATGGCAACGATCAG -3'
(R):5'- AAGATGGTGTCACTTAGTCTGGC -3'

Sequencing Primer
(F):5'- TGGCAACGATCAGACAGATAACTATC -3'
(R):5'- GGCTGTGCTTATTATTTTGCCAAC -3'
Posted On2018-07-24