Incidental Mutation 'R6734:Gsdma2'
ID528351
Institutional Source Beutler Lab
Gene Symbol Gsdma2
Ensembl Gene ENSMUSG00000017211
Gene Namegasdermin A2
Synonyms2210411P14Rik, 2210006M16Rik, 2200001G21Rik, 2210009F20Rik, Gsdm2, Gsdml2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98646759-98657964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98649590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000091470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017355] [ENSMUST00000093938]
Predicted Effect probably benign
Transcript: ENSMUST00000017355
SMART Domains Protein: ENSMUSP00000017355
Gene: ENSMUSG00000017211

DomainStartEndE-ValueType
Pfam:Gasdermin 6 251 2.9e-73 PFAM
low complexity region 259 273 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093938
AA Change: T112A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091470
Gene: ENSMUSG00000017211
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Gasdermin 3 418 9.5e-144 PFAM
low complexity region 426 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138686
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Gsdma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Gsdma2 APN 11 98650974 missense probably damaging 1.00
IGL03091:Gsdma2 APN 11 98652002 missense probably damaging 1.00
IGL03252:Gsdma2 APN 11 98649090 missense probably damaging 1.00
IGL03279:Gsdma2 APN 11 98657723 missense unknown
R0116:Gsdma2 UTSW 11 98649183 missense probably damaging 1.00
R0443:Gsdma2 UTSW 11 98657688 missense probably damaging 1.00
R0521:Gsdma2 UTSW 11 98654901 nonsense probably null
R0626:Gsdma2 UTSW 11 98651984 missense probably damaging 0.96
R1163:Gsdma2 UTSW 11 98650858 missense probably damaging 0.96
R1340:Gsdma2 UTSW 11 98657649 missense probably damaging 0.97
R1834:Gsdma2 UTSW 11 98649079 missense probably damaging 1.00
R1972:Gsdma2 UTSW 11 98650918 missense probably benign 0.04
R2344:Gsdma2 UTSW 11 98655591 missense probably damaging 1.00
R2964:Gsdma2 UTSW 11 98657259 missense probably damaging 1.00
R4093:Gsdma2 UTSW 11 98650851 missense probably benign 0.42
R4256:Gsdma2 UTSW 11 98651932 intron probably null
R4711:Gsdma2 UTSW 11 98649613 missense probably damaging 0.96
R5175:Gsdma2 UTSW 11 98652612 missense probably benign 0.01
R6909:Gsdma2 UTSW 11 98652557 nonsense probably null
R7621:Gsdma2 UTSW 11 98649549 missense probably benign
R7749:Gsdma2 UTSW 11 98657721 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCTCTCTAGCAGTGCTGTGC -3'
(R):5'- TGCTTCCAATTACATGCACTAC -3'

Sequencing Primer
(F):5'- CAGTGCTGTGCTGATGAGTC -3'
(R):5'- TCTTAGCCATCCTGAGAGGTACAG -3'
Posted On2018-07-24