Incidental Mutation 'R6734:Zscan12'
ID528353
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21368796 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 263 (C263*)
Ref Sequence ENSEMBL: ENSMUSP00000153548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect probably null
Transcript: ENSMUST00000053293
AA Change: C263*
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: C263*

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099720
AA Change: C263*
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: C263*

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225545
AA Change: C263*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R2931:Zscan12 UTSW 13 21364017 missense possibly damaging 0.92
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R4545:Zscan12 UTSW 13 21366705 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R7462:Zscan12 UTSW 13 21369287 missense possibly damaging 0.94
R7505:Zscan12 UTSW 13 21368586 missense possibly damaging 0.72
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGAACAGAATCCTGCTAGC -3'
(R):5'- TCCTGATGGGTAGCAAGAGATG -3'

Sequencing Primer
(F):5'- AGAATCCTGCTAGCAGATTAGC -3'
(R):5'- CCACAATCGTTGCATTCGTAGGG -3'
Posted On2018-07-24