Incidental Mutation 'R6734:Naa35'
ID528354
Institutional Source Beutler Lab
Gene Symbol Naa35
Ensembl Gene ENSMUSG00000021555
Gene NameN(alpha)-acetyltransferase 35, NatC auxiliary subunit
SynonymsMak10, A330021G12Rik, C030004C14Rik, A330027C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59585259-59635922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 59608191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 147 (L147R)
Ref Sequence ENSEMBL: ENSMUSP00000127270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000164011] [ENSMUST00000166923] [ENSMUST00000172419]
Predicted Effect probably benign
Transcript: ENSMUST00000022038
AA Change: L225R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555
AA Change: L225R

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163395
Predicted Effect possibly damaging
Transcript: ENSMUST00000164011
AA Change: L147R

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127270
Gene: ENSMUSG00000021555
AA Change: L147R

DomainStartEndE-ValueType
Pfam:Mak10 1 119 1.9e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166923
AA Change: L216R

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128097
Gene: ENSMUSG00000021555
AA Change: L216R

DomainStartEndE-ValueType
Pfam:Mak10 44 188 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171391
Predicted Effect probably benign
Transcript: ENSMUST00000172166
Predicted Effect probably benign
Transcript: ENSMUST00000172419
AA Change: L221R

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126079
Gene: ENSMUSG00000021555
AA Change: L221R

DomainStartEndE-ValueType
Pfam:Mak10 40 193 1.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225670
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Naa35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Naa35 APN 13 59630055 missense probably damaging 1.00
IGL00743:Naa35 APN 13 59630671 missense probably benign 0.33
IGL01335:Naa35 APN 13 59616796 missense probably damaging 1.00
IGL01385:Naa35 APN 13 59601066 missense probably damaging 1.00
IGL01541:Naa35 APN 13 59600963 missense probably damaging 1.00
IGL02129:Naa35 APN 13 59609525 missense probably damaging 0.99
IGL02867:Naa35 APN 13 59608854 intron probably benign
IGL02966:Naa35 APN 13 59586271 missense probably benign
IGL03260:Naa35 APN 13 59627885 missense probably benign 0.05
R0312:Naa35 UTSW 13 59609581 missense probably benign 0.01
R0557:Naa35 UTSW 13 59627964 missense probably damaging 0.99
R1553:Naa35 UTSW 13 59618279 critical splice donor site probably null
R1611:Naa35 UTSW 13 59628933 missense probably benign 0.01
R1676:Naa35 UTSW 13 59612676 missense probably damaging 1.00
R3709:Naa35 UTSW 13 59618032 splice site probably benign
R3896:Naa35 UTSW 13 59607295 missense probably damaging 1.00
R5001:Naa35 UTSW 13 59625531 missense possibly damaging 0.75
R5647:Naa35 UTSW 13 59622866 unclassified probably benign
R5649:Naa35 UTSW 13 59622866 unclassified probably benign
R5650:Naa35 UTSW 13 59622866 unclassified probably benign
R5656:Naa35 UTSW 13 59622866 unclassified probably benign
R6735:Naa35 UTSW 13 59625564 missense probably damaging 1.00
R6985:Naa35 UTSW 13 59627943 missense probably benign 0.03
R7165:Naa35 UTSW 13 59586183 missense probably benign 0.05
R7531:Naa35 UTSW 13 59617941 nonsense probably null
R7713:Naa35 UTSW 13 59598105 missense probably benign 0.01
R7739:Naa35 UTSW 13 59599784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATACATGCATAAAACATTCATGGG -3'
(R):5'- CCCAGGAACACTTAAGTTTTGAAGTC -3'

Sequencing Primer
(F):5'- ACATTCATGGGAAAAATACTAGACAC -3'
(R):5'- CTAAAGGGGCTTCCATGAA -3'
Posted On2018-07-24