Incidental Mutation 'R6734:Dennd6a'
ID528355
Institutional Source Beutler Lab
Gene Symbol Dennd6a
Ensembl Gene ENSMUSG00000040818
Gene NameDENN/MADD domain containing 6A
SynonymsA630054L15Rik, Fam116a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location26573856-26634322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26608619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 115 (R115L)
Ref Sequence ENSEMBL: ENSMUSP00000152966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037585] [ENSMUST00000203874] [ENSMUST00000224111] [ENSMUST00000224248] [ENSMUST00000224378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037585
AA Change: R339L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818
AA Change: R339L

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203874
AA Change: R339L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818
AA Change: R339L

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224111
AA Change: R115L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224248
AA Change: R115L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000224378
AA Change: R115L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225206
Meta Mutation Damage Score 0.1803 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Dennd6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dennd6a APN 14 26608613 missense probably damaging 1.00
IGL01011:Dennd6a APN 14 26603054 missense probably damaging 0.99
IGL01395:Dennd6a APN 14 26616901 nonsense probably null
IGL01559:Dennd6a APN 14 26608565 missense probably damaging 1.00
IGL01590:Dennd6a APN 14 26619352 missense probably benign 0.40
IGL02187:Dennd6a APN 14 26606926 missense probably benign
IGL03296:Dennd6a APN 14 26616960 critical splice donor site probably null
R1831:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R1833:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R2020:Dennd6a UTSW 14 26612003 missense probably damaging 0.99
R2032:Dennd6a UTSW 14 26604749 missense probably benign 0.42
R2036:Dennd6a UTSW 14 26608119 missense probably damaging 0.99
R3707:Dennd6a UTSW 14 26592391 splice site probably benign
R4112:Dennd6a UTSW 14 26628518 intron probably benign
R4728:Dennd6a UTSW 14 26627420 missense probably null 1.00
R5053:Dennd6a UTSW 14 26608583 missense probably damaging 1.00
R5760:Dennd6a UTSW 14 26612040 missense probably damaging 0.99
R5774:Dennd6a UTSW 14 26579819 missense probably benign
R5775:Dennd6a UTSW 14 26619373 nonsense probably null
R6238:Dennd6a UTSW 14 26616658 critical splice donor site probably null
R6446:Dennd6a UTSW 14 26629534 missense probably damaging 1.00
R7289:Dennd6a UTSW 14 26612038 missense probably damaging 1.00
R7436:Dennd6a UTSW 14 26579710 nonsense probably null
R7887:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
R7970:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
RF003:Dennd6a UTSW 14 26629534 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTGATATGGAGTTACACCTC -3'
(R):5'- CTGCAGCAGATACTATATTAGCAGG -3'

Sequencing Primer
(F):5'- AGAGACCAGTGCTTACATAATACTG -3'
(R):5'- CATGTATGTTCTTCTAAAACTTGAGC -3'
Posted On2018-07-24