Incidental Mutation 'R6734:Ano6'
ID528359
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95949536 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 554 (K554R)
Ref Sequence ENSEMBL: ENSMUSP00000071770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: K554R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: K554R

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: K575R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCAGCTATATTAAGGAATGG -3'
(R):5'- TATTCATTAGGCAGCTGAGAGAAAG -3'

Sequencing Primer
(F):5'- AAGCAGATTAAATTGAAACAGTGTG -3'
(R):5'- GCAAGCAGACGACTCAGC -3'
Posted On2018-07-24