Incidental Mutation 'R6734:Prpf40b'
ID528360
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Namepre-mRNA processing factor 40B
Synonyms2610317D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99295087-99317018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99314903 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 627 (R627W)
Ref Sequence ENSEMBL: ENSMUSP00000023745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
Predicted Effect probably damaging
Transcript: ENSMUST00000023745
AA Change: R627W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118287
AA Change: R627W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124275
Predicted Effect probably benign
Transcript: ENSMUST00000126955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130575
Predicted Effect unknown
Transcript: ENSMUST00000134034
AA Change: R9W
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007
AA Change: R9W

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136980
AA Change: R614W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007
AA Change: R614W

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139330
Predicted Effect probably damaging
Transcript: ENSMUST00000145482
AA Change: R627W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007
AA Change: R627W

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153692
Meta Mutation Damage Score 0.4298 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0284:Prpf40b UTSW 15 99316393 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1220:Prpf40b UTSW 15 99316348 missense probably benign 0.10
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4449:Prpf40b UTSW 15 99314663 missense probably damaging 1.00
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6776:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCAATAGTGTGAGGGGAC -3'
(R):5'- AGCACTGCTGATCAGACCAG -3'

Sequencing Primer
(F):5'- AAGCCTGGGTGGTCCTCTC -3'
(R):5'- TGGACCAGCTTGGACACC -3'
Posted On2018-07-24