Incidental Mutation 'R6734:Klhl24'
ID528362
Institutional Source Beutler Lab
Gene Symbol Klhl24
Ensembl Gene ENSMUSG00000062901
Gene Namekelch-like 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20097542-20129221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20107529 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000023509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023509] [ENSMUST00000231842] [ENSMUST00000232088]
Predicted Effect probably damaging
Transcript: ENSMUST00000023509
AA Change: V269A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023509
Gene: ENSMUSG00000062901
AA Change: V269A

DomainStartEndE-ValueType
BTB 66 163 3.49e-29 SMART
BACK 168 270 1.53e-38 SMART
Kelch 314 363 8.21e-2 SMART
Kelch 364 407 6.04e-3 SMART
Kelch 408 454 5.71e-13 SMART
Kelch 455 502 1.51e-3 SMART
Kelch 503 544 9.19e-1 SMART
Kelch 545 592 2.43e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231842
Predicted Effect probably benign
Transcript: ENSMUST00000232088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232494
Meta Mutation Damage Score 0.2679 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin ligase substrate receptor and is regulated by autoubiquitination. Variations in the translation initiation codon of this gene have been found, which result in an N-terminally truncated but more stable protein due to loss of the autoubiquitination function. The more stable mutant protein causes an increased ubiquitin and degradation of keratin 14, which leads to skin fragility and the potentially life-threatening disease epidermolysis bullosa. The encoded protein is also involved in the regulation of kainate receptors. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Klhl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Klhl24 APN 16 20122967 missense possibly damaging 0.78
IGL02419:Klhl24 APN 16 20107368 nonsense probably null
IGL02504:Klhl24 APN 16 20115943 nonsense probably null
IGL02799:Klhl24 UTSW 16 20114581 missense probably damaging 1.00
PIT4585001:Klhl24 UTSW 16 20106888 missense probably benign
R1512:Klhl24 UTSW 16 20122936 missense probably damaging 1.00
R1658:Klhl24 UTSW 16 20107092 nonsense probably null
R2076:Klhl24 UTSW 16 20117878 missense probably damaging 0.98
R2504:Klhl24 UTSW 16 20120167 missense probably benign 0.00
R4084:Klhl24 UTSW 16 20114562 missense probably damaging 0.98
R4299:Klhl24 UTSW 16 20107004 missense probably damaging 1.00
R4624:Klhl24 UTSW 16 20120123 missense probably damaging 1.00
R4780:Klhl24 UTSW 16 20106958 missense probably damaging 0.99
R5652:Klhl24 UTSW 16 20120247 nonsense probably null
R5827:Klhl24 UTSW 16 20120121 nonsense probably null
R6363:Klhl24 UTSW 16 20120183 missense possibly damaging 0.52
R7069:Klhl24 UTSW 16 20107481 missense probably benign 0.06
R7361:Klhl24 UTSW 16 20118000 missense probably benign
R7482:Klhl24 UTSW 16 20114655 missense possibly damaging 0.48
R7894:Klhl24 UTSW 16 20123000 missense probably damaging 1.00
R7977:Klhl24 UTSW 16 20123000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGAAGAATTTCTCGAGCTTG -3'
(R):5'- ACACTGAGACTGAGTTCACG -3'

Sequencing Primer
(F):5'- TCTCGAGCTTGACAAAGATGAAC -3'
(R):5'- GTAAAGCACCTTCTCACC -3'
Posted On2018-07-24