Mutagenetix > Incidental Mutations

Incidental Mutation 'R6734:Liph'

528363

Institutional Source

Beutler Lab

Gene Symbol

Liph

Ensembl Gene

ENSMUSG00000044626

Gene Name

lipase, member H

Synonyms

D16Wsu119e, mPA-PLA1, PLA1B, C130037N08Rik, LPDLR, Lpdlr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6734 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21953817-21995663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21983957 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 121 (S121P)

Ref Sequence

ENSEMBL: ENSMUSP00000073853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060673] [ENSMUST00000074230] [ENSMUST00000231682] [ENSMUST00000231766]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060673
AA Change: S121P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000062310
Gene: ENSMUSG00000044626
AA Change: S121P

Domain	Start	End	E-Value	Type
Pfam:Lipase	11	326	6.8e-82	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000074230
AA Change: S121P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073853
Gene: ENSMUSG00000044626
AA Change: S121P

Domain	Start	End	E-Value	Type
Pfam:Lipase	15	214	1.5e-45	PFAM
Pfam:Abhydrolase_6	73	296	2.3e-6	PFAM
Pfam:Lipase	209	296	1.7e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231682
AA Change: S121P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231766
AA Change: S121P

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.2975

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit wavy vibrissae and wavy and matted coats associated with impaired inner rooth sheath formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Ano6	A	G	15: 95,949,536	K554R	probably damaging	Het
Arhgef10	A	T	8: 14,975,053	I703F	probably damaging	Het
Bbs1	T	C	19: 4,903,896	S80G	probably benign	Het
Bhlhe40	TG	TGG	6: 108,664,857		probably null	Het
Camk1	C	A	6: 113,334,384	R352L	probably benign	Het
Cand1	G	A	10: 119,211,992	P531L	possibly damaging	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Col24a1	C	A	3: 145,508,674	P1384Q	probably benign	Het
Csmd2	C	A	4: 128,463,813	T1689K	probably benign	Het
Cyp26a1	T	A	19: 37,701,212	L452H	probably damaging	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dennd6a	G	T	14: 26,608,619	R115L	possibly damaging	Het
Eml2	T	A	7: 19,200,507	V377E	probably benign	Het
Fam135b	T	C	15: 71,462,780	E855G	probably benign	Het
Fam149a	A	T	8: 45,381,441	I107K	probably benign	Het
Fam227b	A	T	2: 126,126,976	Y59*	probably null	Het
Fbn2	T	C	18: 58,035,960	E2249G	probably damaging	Het
Flrt1	T	C	19: 7,096,159	D341G	possibly damaging	Het
Galnt9	G	A	5: 110,620,599	R587H	probably damaging	Het
Gm10334	T	C	6: 41,445,387	Y28C	probably damaging	Het
Gsdma2	A	G	11: 98,649,590	T112A	possibly damaging	Het
Klhl24	T	C	16: 20,107,529	V269A	probably damaging	Het
Lcorl	A	G	5: 45,733,497	S505P	probably damaging	Het
Lrp4	G	A	2: 91,485,897	V787M	possibly damaging	Het
Lrrd1	A	C	5: 3,850,226	D177A	possibly damaging	Het
Mbd1	G	A	18: 74,276,043	R399H	probably damaging	Het
Naa25	C	T	5: 121,438,825	T879M	possibly damaging	Het
Naa35	T	G	13: 59,608,191	L147R	possibly damaging	Het
Ninl	C	A	2: 150,945,083		probably null	Het
Nrap	T	C	19: 56,345,509	D972G	probably damaging	Het
Olfr827	A	G	10: 130,210,257	F291S	probably benign	Het
Pdzd2	T	C	15: 12,592,465	E31G	probably damaging	Het
Plec	C	T	15: 76,194,403	E41K	probably damaging	Het
Plxnb1	A	T	9: 109,108,920	K1245*	probably null	Het
Ppfia1	T	C	7: 144,479,053	T1263A	probably damaging	Het
Prex2	G	A	1: 11,080,059	V152I	probably damaging	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Prune2	T	G	19: 17,003,733	F85V	probably damaging	Het
Rrp1b	T	G	17: 32,055,304		probably benign	Het
Sec62	A	G	3: 30,810,460	T158A	probably benign	Het
Sema6a	G	A	18: 47,279,169	T526I	probably benign	Het
Shank1	G	T	7: 44,353,686	A1610S	probably benign	Het
Slc24a4	T	C	12: 102,219,000	V123A	probably damaging	Het
Stk11ip	T	C	1: 75,532,369	V714A	probably benign	Het
Tas1r3	T	C	4: 155,860,800	T655A	probably damaging	Het
Tns2	G	T	15: 102,103,116	L10F	probably damaging	Het
Trmt10c	A	G	16: 56,034,126	V382A	probably benign	Het
Unc45a	G	C	7: 80,336,998	T149R	probably damaging	Het
Zhx3	T	G	2: 160,781,720	I176L	probably damaging	Het
Zscan12	T	A	13: 21,368,796	C263*	probably null	Het

Other mutations in Liph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Liph	APN	16	21968140	missense	probably damaging	1.00
babyback	UTSW	16	21983957	missense	probably damaging	0.97
PIT4131001:Liph	UTSW	16	21995369	start codon destroyed	probably null	0.59
R0004:Liph	UTSW	16	21984194	nonsense	probably null
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0045:Liph	UTSW	16	21968053	missense	probably damaging	1.00
R0348:Liph	UTSW	16	21967980	splice site	probably null
R0689:Liph	UTSW	16	21968068	missense	probably damaging	1.00
R0715:Liph	UTSW	16	21995350	missense	probably benign	0.05
R1104:Liph	UTSW	16	21984148	missense	possibly damaging	0.82
R1779:Liph	UTSW	16	21968050	missense	probably benign	0.01
R2323:Liph	UTSW	16	21984004	missense	probably damaging	0.99
R3913:Liph	UTSW	16	21962259	splice site	probably benign
R4402:Liph	UTSW	16	21976250	missense	probably damaging	1.00
R4454:Liph	UTSW	16	21984268	missense	probably benign	0.11
R4672:Liph	UTSW	16	21984056	missense	probably benign	0.14
R4681:Liph	UTSW	16	21984027	missense	probably benign	0.02
R5111:Liph	UTSW	16	21984070	missense	probably damaging	1.00
R5135:Liph	UTSW	16	21956165	nonsense	probably null
R5235:Liph	UTSW	16	21984035	missense	probably damaging	1.00
R5642:Liph	UTSW	16	21965995	missense	possibly damaging	0.61
R5810:Liph	UTSW	16	21968110	missense	probably damaging	1.00
R6188:Liph	UTSW	16	21984268	missense	probably benign	0.11
R6557:Liph	UTSW	16	21983920	missense	possibly damaging	0.60
R7011:Liph	UTSW	16	21984097	missense	probably damaging	0.98
R7038:Liph	UTSW	16	21976259	missense	probably damaging	1.00
R7178:Liph	UTSW	16	21976328	missense	probably damaging	1.00
R7185:Liph	UTSW	16	21995339	missense	probably benign	0.00
R7198:Liph	UTSW	16	21966022	missense	probably damaging	1.00
R7775:Liph	UTSW	16	21958914	missense	probably damaging	1.00
R7832:Liph	UTSW	16	21962236	missense	probably benign	0.01
R7915:Liph	UTSW	16	21962236	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATTCGGATTCGCACAAGGTTAC -3'
(R):5'- CTGTGCACAGATCATCAACTCC -3'

Sequencing Primer
(F):5'- TCGGATTCGCACAAGGTTACAAAATG -3'
(R):5'- TCAACTCCACAGCTCTGGG -3'

Posted On

2018-07-24