Incidental Mutation 'R6734:Mbd1'
ID528368
Institutional Source Beutler Lab
Gene Symbol Mbd1
Ensembl Gene ENSMUSG00000024561
Gene Namemethyl-CpG binding domain protein 1
SynonymsPCM1, Cxxc3
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_013594.2; MGI:1333811

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6734 (G1)
Quality Score135.008
Status Validated
Chromosome18
Chromosomal Location74267605-74282732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74276043 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 399 (R399H)
Ref Sequence ENSEMBL: ENSMUSP00000153428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097530] [ENSMUST00000224047] [ENSMUST00000224332]
Predicted Effect probably benign
Transcript: ENSMUST00000097530
SMART Domains Protein: ENSMUSP00000095137
Gene: ENSMUSG00000024561

DomainStartEndE-ValueType
MBD 3 76 3.94e-27 SMART
low complexity region 82 97 N/A INTRINSIC
low complexity region 123 153 N/A INTRINSIC
Pfam:zf-CXXC 194 241 1.9e-13 PFAM
Pfam:zf-CXXC 243 288 1.2e-13 PFAM
low complexity region 358 368 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224047
AA Change: R399H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224159
Predicted Effect probably benign
Transcript: ENSMUST00000224332
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype Strain: 2664084
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null exhibited defects in adult hippocampal neurogenesis and function. Spatial learning was also impaired in mutant mice. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Mbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Mbd1 APN 18 74275239 missense possibly damaging 0.72
IGL01551:Mbd1 APN 18 74269543 unclassified probably benign
IGL02213:Mbd1 APN 18 74275382 missense probably damaging 1.00
IGL02562:Mbd1 APN 18 74276922 missense probably benign 0.00
IGL02596:Mbd1 APN 18 74276797 splice site probably benign
IGL02944:Mbd1 APN 18 74277410 missense probably damaging 1.00
IGL02973:Mbd1 APN 18 74275427 splice site probably benign
IGL03200:Mbd1 APN 18 74276431 missense probably benign 0.02
IGL03247:Mbd1 APN 18 74274754 nonsense probably null
IGL03340:Mbd1 APN 18 74274482 missense probably benign 0.00
FR4737:Mbd1 UTSW 18 74273573 small deletion probably benign
P0016:Mbd1 UTSW 18 74274538 nonsense probably null
R0385:Mbd1 UTSW 18 74273241 frame shift probably null
R0630:Mbd1 UTSW 18 74276727 splice site probably benign
R0717:Mbd1 UTSW 18 74273597 missense possibly damaging 0.89
R1084:Mbd1 UTSW 18 74269532 missense probably damaging 1.00
R1290:Mbd1 UTSW 18 74269486 missense possibly damaging 0.59
R1575:Mbd1 UTSW 18 74275419 critical splice donor site probably null
R2065:Mbd1 UTSW 18 74276884 missense probably damaging 1.00
R2192:Mbd1 UTSW 18 74277378 missense probably damaging 0.99
R2308:Mbd1 UTSW 18 74276477 missense probably benign 0.42
R2697:Mbd1 UTSW 18 74273617 missense possibly damaging 0.95
R3407:Mbd1 UTSW 18 74277367 missense possibly damaging 0.94
R4348:Mbd1 UTSW 18 74274416 missense probably damaging 1.00
R4664:Mbd1 UTSW 18 74269526 missense possibly damaging 0.86
R5460:Mbd1 UTSW 18 74269510 missense probably benign 0.03
R5860:Mbd1 UTSW 18 74276697 nonsense probably null
R6431:Mbd1 UTSW 18 74273691 intron probably null
R6861:Mbd1 UTSW 18 74273574
R7363:Mbd1 UTSW 18 74273286 missense probably damaging 0.97
R7543:Mbd1 UTSW 18 74274449 missense probably damaging 0.97
R7657:Mbd1 UTSW 18 74274733 missense probably damaging 0.99
R7871:Mbd1 UTSW 18 74274057 critical splice donor site probably null
R7954:Mbd1 UTSW 18 74274057 critical splice donor site probably null
RF005:Mbd1 UTSW 18 74273573 small deletion probably benign
RF011:Mbd1 UTSW 18 74273610 small deletion probably benign
RF024:Mbd1 UTSW 18 74273573 small deletion probably benign
RF024:Mbd1 UTSW 18 74273610 small deletion probably benign
RF058:Mbd1 UTSW 18 74273609 frame shift probably null
Z1177:Mbd1 UTSW 18 74276939
Predicted Primers PCR Primer
(F):5'- TGTAGGTAGCTCCTCCATGAG -3'
(R):5'- TGGCAGTACCAGCTAGACTC -3'

Sequencing Primer
(F):5'- AGGATGGCCCTTAGTGACG -3'
(R):5'- TGGCAGTACCAGCTAGACTCATTTAC -3'
Posted On2018-07-24