Incidental Mutation 'R6734:Bbs1'
ID528369
Institutional Source Beutler Lab
Gene Symbol Bbs1
Ensembl Gene ENSMUSG00000006464
Gene NameBardet-Biedl syndrome 1 (human)
SynonymsD19Ertd609e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4886898-4906627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4903896 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 80 (S80G)
Ref Sequence ENSEMBL: ENSMUSP00000055321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851] [ENSMUST00000053506]
Predicted Effect probably benign
Transcript: ENSMUST00000025851
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053506
AA Change: S80G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: S80G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158036
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Bbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bbs1 APN 19 4893010 missense probably benign
IGL01110:Bbs1 APN 19 4892925 missense possibly damaging 0.93
IGL01116:Bbs1 APN 19 4902839 splice site probably benign
IGL01480:Bbs1 APN 19 4894393 missense probably damaging 1.00
IGL01926:Bbs1 APN 19 4902863 missense probably benign 0.01
IGL02893:Bbs1 APN 19 4897576 nonsense probably null
IGL03136:Bbs1 APN 19 4890991 missense probably benign 0.10
IGL03342:Bbs1 APN 19 4897593 missense probably damaging 1.00
bookface UTSW 19 4897326 missense possibly damaging 0.81
PIT4131001:Bbs1 UTSW 19 4899259 missense possibly damaging 0.83
PIT4378001:Bbs1 UTSW 19 4891675 missense probably benign 0.05
PIT4468001:Bbs1 UTSW 19 4906162 missense probably benign 0.19
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0127:Bbs1 UTSW 19 4895029 missense probably benign 0.05
R1423:Bbs1 UTSW 19 4894263 missense probably benign 0.08
R1760:Bbs1 UTSW 19 4894322 missense probably benign 0.10
R1992:Bbs1 UTSW 19 4891708 missense probably benign
R2145:Bbs1 UTSW 19 4903707 missense possibly damaging 0.71
R4097:Bbs1 UTSW 19 4897317 missense probably damaging 1.00
R5717:Bbs1 UTSW 19 4897326 missense possibly damaging 0.81
R5947:Bbs1 UTSW 19 4892994 missense probably benign 0.27
R6005:Bbs1 UTSW 19 4903795 nonsense probably null
R6175:Bbs1 UTSW 19 4890721 missense probably damaging 1.00
R6597:Bbs1 UTSW 19 4899306 missense probably benign 0.01
R6772:Bbs1 UTSW 19 4906590 unclassified probably benign
R6805:Bbs1 UTSW 19 4900615 missense probably damaging 1.00
R6838:Bbs1 UTSW 19 4903852 missense possibly damaging 0.47
R7198:Bbs1 UTSW 19 4895015 missense probably damaging 0.97
R7276:Bbs1 UTSW 19 4897710 intron probably null
R7685:Bbs1 UTSW 19 4906154 missense probably benign 0.43
R7696:Bbs1 UTSW 19 4890989 critical splice donor site probably null
Y5404:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Y5407:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACGTCCTGTTCCAAAGGGTTTG -3'
(R):5'- TCGCCAGGCCTATAATTCAGG -3'

Sequencing Primer
(F):5'- CAAAGGGTTTGGAGGTAACTGG -3'
(R):5'- GGCATTCCCATTTTGCAAGAGAG -3'
Posted On2018-07-24