Incidental Mutation 'R6734:Cyp26a1'
ID528372
Institutional Source Beutler Lab
Gene Symbol Cyp26a1
Ensembl Gene ENSMUSG00000024987
Gene Namecytochrome P450, family 26, subfamily a, polypeptide 1
SynonymsCyp26, P450RA, P450RAI, retinoic acid hydrolase, RAH
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37697808-37701528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37701212 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 452 (L452H)
Ref Sequence ENSEMBL: ENSMUSP00000025946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946]
Predicted Effect probably damaging
Transcript: ENSMUST00000025946
AA Change: L452H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987
AA Change: L452H

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die during mid-late gestation and exhibit spina bifida, caudal agenesis, and abnormalities of the kidneys, urogenital tract, hindgut, cervical vertebrae, and rostral hindbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Cyp26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cyp26a1 APN 19 37700002 missense probably benign 0.00
IGL01398:Cyp26a1 APN 19 37697947 missense probably damaging 1.00
IGL01624:Cyp26a1 APN 19 37698333 missense possibly damaging 0.94
IGL02398:Cyp26a1 APN 19 37700019 missense probably benign
IGL02437:Cyp26a1 APN 19 37698495 missense probably benign
IGL02709:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
IGL02712:Cyp26a1 APN 19 37699978 missense probably damaging 1.00
R0834:Cyp26a1 UTSW 19 37699957 missense probably damaging 0.96
R1517:Cyp26a1 UTSW 19 37698860 missense probably benign
R1696:Cyp26a1 UTSW 19 37701178 missense probably benign 0.02
R1831:Cyp26a1 UTSW 19 37700623 missense probably damaging 0.98
R2040:Cyp26a1 UTSW 19 37698051 missense possibly damaging 0.46
R2504:Cyp26a1 UTSW 19 37698342 missense probably damaging 1.00
R4693:Cyp26a1 UTSW 19 37698477 missense probably benign 0.11
R4808:Cyp26a1 UTSW 19 37701125 missense probably benign
R5124:Cyp26a1 UTSW 19 37701217 missense probably benign 0.01
R5412:Cyp26a1 UTSW 19 37701182 missense probably damaging 1.00
R5964:Cyp26a1 UTSW 19 37699962 missense probably damaging 1.00
R6355:Cyp26a1 UTSW 19 37698929 missense possibly damaging 0.46
R6426:Cyp26a1 UTSW 19 37699305 missense probably benign 0.14
R6501:Cyp26a1 UTSW 19 37699070 missense possibly damaging 0.80
R7019:Cyp26a1 UTSW 19 37698812 missense probably damaging 1.00
R7188:Cyp26a1 UTSW 19 37699305 missense possibly damaging 0.64
R7667:Cyp26a1 UTSW 19 37700624 missense possibly damaging 0.83
R7694:Cyp26a1 UTSW 19 37701064 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TTTACAGTATCTGTGACACCCAC -3'
(R):5'- ACCACGGGACTGTAGTAGAGAC -3'

Sequencing Primer
(F):5'- CACGATGTGGCAGATATCTTCAC -3'
(R):5'- TTGTCCACAGGGTACACA -3'
Posted On2018-07-24