Mutagenetix > Incidental Mutation

Incidental Mutation 'R6736:Csmd1'

528425

Institutional Source

Beutler Lab

Gene Symbol

Csmd1

Ensembl Gene

ENSMUSG00000060924

Gene Name

CUB and Sushi multiple domains 1

Synonyms

MMRRC Submission

044854-MU

Accession Numbers

Genbank: NM_053171.2

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15892537-17535586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 16002626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 2166 (Y2166F)

Ref Sequence

ENSEMBL: ENSMUSP00000080751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082104]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082104
AA Change: Y2166F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: Y2166F

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CUB	32	140	1.46e-26	SMART
CCP	145	202	1.01e-11	SMART
CUB	208	312	1.05e-27	SMART
CCP	349	406	1.28e-8	SMART
CUB	411	522	2.34e-25	SMART
CCP	527	580	1.22e-14	SMART
CUB	584	692	1.61e-37	SMART
CCP	697	754	4.41e-12	SMART
CUB	758	866	6.55e-38	SMART
CCP	873	926	2.53e-12	SMART
CUB	930	1040	8.94e-22	SMART
CCP	1045	1100	7.06e-11	SMART
CUB	1104	1212	3.14e-26	SMART
CCP	1217	1273	1.18e-12	SMART
CUB	1277	1386	9.72e-32	SMART
CCP	1391	1447	2.06e-12	SMART
CUB	1451	1559	1.68e-35	SMART
CCP	1564	1621	2.53e-12	SMART
CUB	1625	1733	4.24e-14	SMART
CCP	1741	1798	9.46e-12	SMART
CUB	1802	1910	4.23e-32	SMART
CCP	1915	1970	8.23e-12	SMART
CUB	1974	2082	8.59e-33	SMART
CCP	2087	2142	6.09e-15	SMART
CUB	2146	2253	2.36e-30	SMART
CCP	2258	2315	1.1e-12	SMART
CUB	2320	2430	4.3e-24	SMART
CCP	2432	2490	2.94e-8	SMART
CCP	2495	2552	2.03e-11	SMART
CCP	2557	2617	1.22e-5	SMART
CCP	2622	2675	2.72e-12	SMART
CCP	2680	2733	5.86e-17	SMART
CCP	2738	2791	6.09e-15	SMART
CCP	2796	2854	9.1e-14	SMART
CCP	2859	2912	3.96e-14	SMART
CCP	2920	2973	4.41e-12	SMART
CCP	2978	3032	2.94e-8	SMART
CCP	3037	3092	6.59e-11	SMART
CCP	3097	3150	4.12e-12	SMART
CCP	3155	3208	7.92e-14	SMART
CCP	3216	3270	2.8e-14	SMART
CCP	3275	3330	3.78e-11	SMART
transmembrane domain	3487	3509	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,992,268	I83T	probably benign	Het
Aadacl4	T	G	4: 144,623,339	S389A	possibly damaging	Het
Abca13	A	T	11: 9,465,058	S4042C	probably damaging	Het
Acaca	G	A	11: 84,238,838	V340I	probably benign	Het
Acox3	T	A	5: 35,588,854		probably null	Het
Acsl6	A	C	11: 54,325,166	E124A	probably damaging	Het
Adamtsl1	T	A	4: 86,342,247	H898Q	probably damaging	Het
Agl	A	G	3: 116,781,680	S603P	probably damaging	Het
Apobec1	A	T	6: 122,581,675	M31K	probably null	Het
Armc4	C	A	18: 7,223,586	V486F	probably damaging	Het
Astn1	T	C	1: 158,511,148		probably null	Het
Atp8a1	G	T	5: 67,667,617	D790E	probably damaging	Het
Bahd1	T	G	2: 118,915,975	M25R	possibly damaging	Het
BC034090	A	T	1: 155,241,930	N147K	possibly damaging	Het
Bfsp2	G	T	9: 103,480,204	A8E	possibly damaging	Het
Brwd1	A	T	16: 96,068,572	I85N	probably damaging	Het
Ccdc24	T	A	4: 117,870,535	N145I	possibly damaging	Het
Cdhr5	G	T	7: 141,272,531	Q141K	probably damaging	Het
Cfap46	A	G	7: 139,619,971	V1998A	possibly damaging	Het
Cul4a	T	G	8: 13,136,219	S474A	probably benign	Het
Cutal	A	G	2: 34,888,137	T112A	probably benign	Het
Dcaf6	A	C	1: 165,399,785	S258A	possibly damaging	Het
Dek	C	T	13: 47,099,390	V180M	probably damaging	Het
Dspp	C	A	5: 104,178,175	D801E	unknown	Het
Egflam	T	C	15: 7,219,725	T871A	probably damaging	Het
Erbin	A	T	13: 103,834,766	S781T	possibly damaging	Het
Erich6	A	T	3: 58,625,054	H377Q	probably damaging	Het
Exo5	C	A	4: 120,921,756	G304V	probably damaging	Het
Eya2	C	A	2: 165,716,037	S184R	possibly damaging	Het
Fhod1	G	A	8: 105,337,890		probably benign	Het
G6pc3	A	G	11: 102,193,670	Y302C	possibly damaging	Het
Gart	T	C	16: 91,636,107	D318G	probably benign	Het
Gm10300	T	C	4: 132,074,935		probably benign	Het
Gm11937	A	G	11: 99,610,074	V39A	probably damaging	Het
Gm16432	T	A	1: 178,017,712	Y99*	probably null	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gnas	T	C	2: 174,334,251	M60T	probably damaging	Het
Grk5	G	T	19: 60,890,626	R16L	probably damaging	Het
Hcn3	A	G	3: 89,152,674	L221P	probably damaging	Het
Hddc3	G	A	7: 80,343,196	R20Q	possibly damaging	Het
Hectd4	T	C	5: 121,277,725	Y530H	possibly damaging	Het
Igf2bp1	A	T	11: 95,973,122	H247Q	probably benign	Het
Igkv4-70	T	A	6: 69,267,928	D103V	probably damaging	Het
Itpr2	T	A	6: 146,325,170	M1359L	probably damaging	Het
Kalrn	A	G	16: 34,217,923	L1013S	probably damaging	Het
Kctd21	C	T	7: 97,348,084	R255W	probably damaging	Het
Krt18	T	A	15: 102,030,769	Y263N	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Larp1	G	A	11: 58,042,647		probably null	Het
Lmnb1	A	G	18: 56,728,469	N144S	probably damaging	Het
Lrp2	T	A	2: 69,448,211	T3933S	probably benign	Het
Lrrc34	T	C	3: 30,624,859	N363S	probably benign	Het
Lrriq1	T	C	10: 103,181,889		probably null	Het
Mafa	C	A	15: 75,747,780	G48V	unknown	Het
Mboat4	T	C	8: 34,124,521	S371P	possibly damaging	Het
Mei4	A	T	9: 82,025,624	M237L	probably benign	Het
Mfsd2a	T	C	4: 122,951,261	D219G	probably benign	Het
Msl2	A	G	9: 101,101,002	N192D	probably damaging	Het
Mycbp2	C	A	14: 103,191,567	R2358M	probably null	Het
Myh10	A	G	11: 68,745,339	T185A	probably damaging	Het
Nipsnap2	T	C	5: 129,745,288		probably null	Het
Notch1	T	C	2: 26,460,286	T2281A	probably benign	Het
Olfr1165-ps	C	A	2: 88,101,603	C128F	probably benign	Het
Olfr1436	G	A	19: 12,298,572	Q187*	probably null	Het
Olfr376	G	T	11: 73,375,576	V276F	probably benign	Het
Olfr533	T	C	7: 140,466,887	S229P	probably damaging	Het
Olfr533	G	T	7: 140,466,921	C240F	probably damaging	Het
Olfr735	A	T	14: 50,345,448	N300K	probably damaging	Het
Olfr895	T	A	9: 38,268,570	I19N	probably damaging	Het
Olfr948	A	G	9: 39,318,793	S274P	probably damaging	Het
Oxct1	T	A	15: 4,092,417	S283T	probably benign	Het
Pcnx2	G	T	8: 125,752,317		probably null	Het
Piwil4	A	G	9: 14,715,823	F424L	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Psmc2	T	A	5: 21,800,576	D218E	probably damaging	Het
Ptpn7	C	T	1: 135,139,236	P277L	probably benign	Het
Rgs12	A	G	5: 35,023,092	K27E	probably damaging	Het
Rp1l1	G	T	14: 64,029,724	A920S	possibly damaging	Het
Rsbn1l	A	T	5: 20,908,224	H433Q	probably benign	Het
Safb	C	A	17: 56,606,023	P913Q	possibly damaging	Het
Sema7a	G	A	9: 57,960,571	V477M	probably damaging	Het
Serpina16	T	A	12: 103,668,932	T408S	possibly damaging	Het
Six5	G	A	7: 19,094,991	V119M	possibly damaging	Het
Slc6a16	C	T	7: 45,259,028	P11S	possibly damaging	Het
Smg1	A	G	7: 118,157,166		probably benign	Het
Sntg1	T	A	1: 8,445,050	I420F	probably benign	Het
Sptb	T	C	12: 76,613,180	D982G	possibly damaging	Het
Stag3	T	A	5: 138,301,499	F891I	probably damaging	Het
Sugp1	A	G	8: 70,059,303	E183G	probably benign	Het
Taf1d	T	C	9: 15,307,823		probably null	Het
Tapbp	T	C	17: 33,919,957	S33P	possibly damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubap2	CT	CTTGCCCCGGT	4: 41,227,224		probably benign	Het
Ubash3a	A	G	17: 31,231,415	T355A	probably benign	Het
Usp16	T	G	16: 87,470,397	V225G	probably damaging	Het
Utrn	A	G	10: 12,621,303	V2454A	probably benign	Het
Vmn1r191	G	T	13: 22,179,550	F11L	probably benign	Het
Vmn2r117	A	T	17: 23,478,308	C137S	probably damaging	Het
Zfp143	T	C	7: 110,091,814	M524T	probably damaging	Het
Zfp599	A	G	9: 22,249,844	C342R	probably damaging	Het
Zfp777	T	G	6: 48,024,856	K811Q	probably damaging	Het
Zfp870	T	A	17: 32,883,596	H254L	probably benign	Het

Other mutations in Csmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Csmd1	APN	8	16009297	splice site	probably benign
IGL00433:Csmd1	APN	8	16231373	missense	probably damaging	1.00
IGL00500:Csmd1	APN	8	15921139	missense	probably damaging	1.00
IGL00666:Csmd1	APN	8	16189990	missense	probably damaging	1.00
IGL00913:Csmd1	APN	8	16071287	missense	probably benign	0.00
IGL01012:Csmd1	APN	8	15917341	missense	probably benign	0.00
IGL01123:Csmd1	APN	8	17534928	missense	possibly damaging	0.96
IGL01348:Csmd1	APN	8	15910596	missense	probably damaging	0.99
IGL01444:Csmd1	APN	8	16200055	missense	probably benign	0.00
IGL01530:Csmd1	APN	8	15903195	missense	probably damaging	0.99
IGL01548:Csmd1	APN	8	16288646	nonsense	probably null
IGL01814:Csmd1	APN	8	16501375	missense	probably damaging	1.00
IGL01889:Csmd1	APN	8	15998857	missense	probably damaging	1.00
IGL02055:Csmd1	APN	8	16069001	missense	probably damaging	0.99
IGL02066:Csmd1	APN	8	15926594	missense	probably damaging	1.00
IGL02097:Csmd1	APN	8	16211759	missense	probably null	0.17
IGL02112:Csmd1	APN	8	16081705	missense	probably benign	0.18
IGL02161:Csmd1	APN	8	16358412	missense	probably damaging	0.97
IGL02189:Csmd1	APN	8	16271606	missense	probably damaging	0.99
IGL02272:Csmd1	APN	8	16199893	missense	probably damaging	0.99
IGL02292:Csmd1	APN	8	16211870	missense	probably damaging	1.00
IGL02385:Csmd1	APN	8	15903275	missense	probably benign	0.08
IGL02424:Csmd1	APN	8	16092326	missense	probably benign	0.22
IGL02492:Csmd1	APN	8	16002597	missense	probably benign	0.13
IGL02507:Csmd1	APN	8	17534976	utr 5 prime	probably benign
IGL02513:Csmd1	APN	8	15999869	splice site	probably benign
IGL02727:Csmd1	APN	8	16231327	missense	probably damaging	1.00
IGL02728:Csmd1	APN	8	15999779	critical splice donor site	probably null
IGL02852:Csmd1	APN	8	15895728	missense	probably damaging	0.99
IGL02935:Csmd1	APN	8	16223334	missense	probably damaging	1.00
IGL02945:Csmd1	APN	8	16271570	missense	possibly damaging	0.92
IGL02959:Csmd1	APN	8	15910465	missense	probably damaging	0.99
IGL03113:Csmd1	APN	8	16028698	missense	probably benign
IGL03129:Csmd1	APN	8	15961521	missense	probably damaging	0.99
IGL03131:Csmd1	APN	8	16088217	missense	probably damaging	1.00
IGL03275:Csmd1	APN	8	16157092	missense	probably benign	0.00
IGL03297:Csmd1	APN	8	16009432	nonsense	probably null
ikura	UTSW	8	16231271	missense	probably damaging	1.00
I2289:Csmd1	UTSW	8	15912381	missense	probably benign	0.10
IGL03055:Csmd1	UTSW	8	16095501	missense	probably damaging	1.00
IGL03097:Csmd1	UTSW	8	15945127	missense	probably damaging	1.00
PIT4260001:Csmd1	UTSW	8	16070313	missense	probably damaging	1.00
PIT4378001:Csmd1	UTSW	8	15895728	missense	probably damaging	0.99
PIT4520001:Csmd1	UTSW	8	15906023	missense	probably benign	0.01
R0037:Csmd1	UTSW	8	15917248	missense	probably damaging	0.97
R0095:Csmd1	UTSW	8	16233051	missense	probably damaging	1.00
R0113:Csmd1	UTSW	8	15984849	missense	probably damaging	1.00
R0129:Csmd1	UTSW	8	16079942	missense	possibly damaging	0.95
R0144:Csmd1	UTSW	8	16391824	missense	probably benign	0.16
R0166:Csmd1	UTSW	8	16233022	missense	probably benign	0.29
R0227:Csmd1	UTSW	8	16391822	missense	probably benign	0.05
R0279:Csmd1	UTSW	8	16223235	missense	probably damaging	0.99
R0280:Csmd1	UTSW	8	16271602	missense	probably damaging	1.00
R0312:Csmd1	UTSW	8	15984760	missense	probably damaging	1.00
R0355:Csmd1	UTSW	8	15918330	missense	probably damaging	0.97
R0367:Csmd1	UTSW	8	15917270	missense	probably damaging	1.00
R0395:Csmd1	UTSW	8	16346638	missense	probably damaging	0.99
R0413:Csmd1	UTSW	8	16710514	missense	probably damaging	0.97
R0457:Csmd1	UTSW	8	16501393	critical splice acceptor site	probably null
R0463:Csmd1	UTSW	8	15921759	missense	probably damaging	0.99
R0482:Csmd1	UTSW	8	16233101	missense	probably damaging	1.00
R0501:Csmd1	UTSW	8	17027323	missense	probably damaging	0.97
R0505:Csmd1	UTSW	8	15992758	missense	probably damaging	1.00
R0507:Csmd1	UTSW	8	16185344	splice site	probably benign
R0511:Csmd1	UTSW	8	15932529	missense	possibly damaging	0.80
R0555:Csmd1	UTSW	8	16185273	missense	probably benign
R0580:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R0610:Csmd1	UTSW	8	15918208	missense	possibly damaging	0.95
R0634:Csmd1	UTSW	8	16226391	missense	probably damaging	1.00
R0666:Csmd1	UTSW	8	16069049	missense	possibly damaging	0.88
R0674:Csmd1	UTSW	8	16000550	missense	probably benign	0.03
R0675:Csmd1	UTSW	8	16158131	missense	probably benign	0.01
R0763:Csmd1	UTSW	8	17027284	missense	possibly damaging	0.67
R0781:Csmd1	UTSW	8	15921174	missense	probably benign	0.35
R0862:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0864:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0925:Csmd1	UTSW	8	16710618	missense	probably benign	0.29
R0926:Csmd1	UTSW	8	16033576	splice site	probably null
R1005:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R1073:Csmd1	UTSW	8	16358463	splice site	probably benign
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1256:Csmd1	UTSW	8	16079964	missense	probably damaging	1.00
R1294:Csmd1	UTSW	8	16698036	missense	probably damaging	0.99
R1375:Csmd1	UTSW	8	16463081	splice site	probably null
R1447:Csmd1	UTSW	8	15925306	nonsense	probably null
R1450:Csmd1	UTSW	8	15945180	critical splice acceptor site	probably null
R1470:Csmd1	UTSW	8	16157204	splice site	probably benign
R1580:Csmd1	UTSW	8	15925299	missense	probably damaging	1.00
R1591:Csmd1	UTSW	8	15900710	missense	probably damaging	0.99
R1658:Csmd1	UTSW	8	16081725	missense	possibly damaging	0.69
R1678:Csmd1	UTSW	8	15918252	missense	possibly damaging	0.58
R1717:Csmd1	UTSW	8	17216692	missense	possibly damaging	0.58
R1735:Csmd1	UTSW	8	15932610	missense	probably damaging	0.99
R1750:Csmd1	UTSW	8	15917303	missense	probably damaging	0.99
R1753:Csmd1	UTSW	8	16157120	nonsense	probably null
R1822:Csmd1	UTSW	8	16223326	missense	probably damaging	1.00
R1875:Csmd1	UTSW	8	15929101	missense	probably damaging	0.99
R1909:Csmd1	UTSW	8	15906116	missense	probably damaging	1.00
R1912:Csmd1	UTSW	8	16233998	critical splice donor site	probably null
R1993:Csmd1	UTSW	8	16346684	missense	probably damaging	0.99
R2067:Csmd1	UTSW	8	15900782	missense	probably benign
R2094:Csmd1	UTSW	8	16079978	missense	probably damaging	0.99
R2119:Csmd1	UTSW	8	17216733	missense	probably damaging	0.98
R2127:Csmd1	UTSW	8	15917392	missense	probably damaging	1.00
R2138:Csmd1	UTSW	8	15929088	missense	probably damaging	0.96
R2216:Csmd1	UTSW	8	17027339	critical splice acceptor site	probably null
R2220:Csmd1	UTSW	8	15992641	missense	possibly damaging	0.94
R2380:Csmd1	UTSW	8	16190087	missense	probably damaging	1.00
R2471:Csmd1	UTSW	8	16211762	missense	probably damaging	1.00
R2984:Csmd1	UTSW	8	15953782	missense	probably damaging	1.00
R3001:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3002:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3003:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3103:Csmd1	UTSW	8	15917405	missense	probably damaging	1.00
R3104:Csmd1	UTSW	8	17027231	missense	probably damaging	1.00
R3620:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3621:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3748:Csmd1	UTSW	8	15906071	missense	probably damaging	0.99
R3780:Csmd1	UTSW	8	16201986	missense	probably damaging	1.00
R3815:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3816:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3818:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3819:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3850:Csmd1	UTSW	8	16079922	missense	probably benign	0.00
R3945:Csmd1	UTSW	8	15910619	splice site	probably null
R3980:Csmd1	UTSW	8	15906056	nonsense	probably null
R4061:Csmd1	UTSW	8	15945158	missense	probably benign	0.00
R4086:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4087:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4089:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4183:Csmd1	UTSW	8	15910464	missense	probably damaging	0.99
R4226:Csmd1	UTSW	8	16000490	missense	probably damaging	0.99
R4454:Csmd1	UTSW	8	15945011	missense	probably damaging	0.99
R4533:Csmd1	UTSW	8	15931037	splice site	probably null
R4544:Csmd1	UTSW	8	16710636	missense	possibly damaging	0.93
R4547:Csmd1	UTSW	8	16391797	missense	possibly damaging	0.48
R4612:Csmd1	UTSW	8	15921908	splice site	probably null
R4620:Csmd1	UTSW	8	16002694	critical splice acceptor site	probably null
R4627:Csmd1	UTSW	8	16697917	missense	probably benign	0.00
R4633:Csmd1	UTSW	8	16002620	missense	probably damaging	0.99
R4646:Csmd1	UTSW	8	15932511	missense	possibly damaging	0.87
R4648:Csmd1	UTSW	8	15998788	nonsense	probably null
R4668:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.50
R4709:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.96
R4709:Csmd1	UTSW	8	16710506	critical splice donor site	probably null
R4741:Csmd1	UTSW	8	15910447	missense	probably damaging	0.99
R4774:Csmd1	UTSW	8	16009369	missense	probably benign	0.11
R4793:Csmd1	UTSW	8	16088263	missense	probably damaging	1.00
R4829:Csmd1	UTSW	8	16127296	missense	probably damaging	1.00
R4888:Csmd1	UTSW	8	15895674	utr 3 prime	probably benign
R4896:Csmd1	UTSW	8	16009439	missense	probably benign	0.00
R4932:Csmd1	UTSW	8	16023765	missense	probably damaging	0.99
R4944:Csmd1	UTSW	8	15998772	missense	probably damaging	1.00
R4953:Csmd1	UTSW	8	16199917	missense	probably damaging	0.99
R4996:Csmd1	UTSW	8	15910452	missense	probably damaging	0.97
R5028:Csmd1	UTSW	8	15989090	missense	probably damaging	1.00
R5146:Csmd1	UTSW	8	16196190	missense	probably damaging	1.00
R5272:Csmd1	UTSW	8	16199944	missense	probably damaging	0.99
R5327:Csmd1	UTSW	8	17216712	missense	possibly damaging	0.94
R5399:Csmd1	UTSW	8	16710597	missense	probably damaging	1.00
R5411:Csmd1	UTSW	8	15910471	missense	probably damaging	1.00
R5462:Csmd1	UTSW	8	15961486	missense	probably benign	0.12
R5463:Csmd1	UTSW	8	15984860	missense	probably benign	0.34
R5497:Csmd1	UTSW	8	16085181	missense	probably benign	0.20
R5536:Csmd1	UTSW	8	16288660	missense	probably damaging	0.99
R5711:Csmd1	UTSW	8	15953703	missense	probably damaging	1.00
R5730:Csmd1	UTSW	8	16185192	nonsense	probably null
R5788:Csmd1	UTSW	8	16201966	missense	probably damaging	1.00
R5941:Csmd1	UTSW	8	15932471	missense	probably damaging	0.99
R5960:Csmd1	UTSW	8	16071416	missense	possibly damaging	0.68
R5961:Csmd1	UTSW	8	16070352	missense	probably damaging	0.99
R5969:Csmd1	UTSW	8	16071353	missense	probably benign	0.00
R5998:Csmd1	UTSW	8	15910443	missense	probably damaging	1.00
R6062:Csmd1	UTSW	8	16092305	missense	possibly damaging	0.68
R6109:Csmd1	UTSW	8	16199860	missense	possibly damaging	0.93
R6116:Csmd1	UTSW	8	16211850	missense	probably damaging	1.00
R6143:Csmd1	UTSW	8	16088301	missense	probably damaging	1.00
R6155:Csmd1	UTSW	8	15903231	missense	probably benign	0.01
R6197:Csmd1	UTSW	8	15926611	missense	probably benign	0.32
R6247:Csmd1	UTSW	8	16196235	missense	possibly damaging	0.91
R6304:Csmd1	UTSW	8	16058674	missense	probably damaging	1.00
R6317:Csmd1	UTSW	8	16710642	missense	possibly damaging	0.89
R6318:Csmd1	UTSW	8	15903212	missense	probably damaging	1.00
R6338:Csmd1	UTSW	8	15932492	missense	possibly damaging	0.75
R6369:Csmd1	UTSW	8	17535004	start gained	probably benign
R6447:Csmd1	UTSW	8	15910527	missense	probably damaging	1.00
R6454:Csmd1	UTSW	8	15921150	missense	probably damaging	0.99
R6494:Csmd1	UTSW	8	16211695	splice site	probably null
R6614:Csmd1	UTSW	8	17216787	missense	probably damaging	1.00
R6769:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6771:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6804:Csmd1	UTSW	8	16037246	missense	probably damaging	1.00
R6818:Csmd1	UTSW	8	16185327	missense	probably damaging	1.00
R6863:Csmd1	UTSW	8	17534913	missense	possibly damaging	0.85
R6930:Csmd1	UTSW	8	16092395	missense	probably damaging	0.97
R6969:Csmd1	UTSW	8	17216789	missense	possibly damaging	0.94
R7112:Csmd1	UTSW	8	16101128	missense	probably damaging	1.00
R7124:Csmd1	UTSW	8	15903202	missense	probably damaging	1.00
R7167:Csmd1	UTSW	8	15926524	missense	probably benign
R7243:Csmd1	UTSW	8	15915357	missense	probably damaging	1.00
R7260:Csmd1	UTSW	8	16000574	missense	probably damaging	1.00
R7271:Csmd1	UTSW	8	17027279	missense	probably damaging	0.99
R7324:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7325:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7327:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7373:Csmd1	UTSW	8	15992713	missense	probably damaging	1.00
R7406:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R7427:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7428:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7445:Csmd1	UTSW	8	16158254	missense	possibly damaging	0.61
R7458:Csmd1	UTSW	8	15953738	missense	probably damaging	1.00
R7476:Csmd1	UTSW	8	15895731	missense	probably damaging	1.00
R7527:Csmd1	UTSW	8	16211718	missense	probably damaging	1.00
R7544:Csmd1	UTSW	8	16092296	missense	probably damaging	1.00
R7583:Csmd1	UTSW	8	15998833	missense	probably damaging	0.96
R7603:Csmd1	UTSW	8	16288682	missense	probably damaging	1.00
R7607:Csmd1	UTSW	8	15918331	missense	possibly damaging	0.94
R7642:Csmd1	UTSW	8	16085178	missense	probably damaging	0.99
R7669:Csmd1	UTSW	8	15917273	missense	probably damaging	1.00
R7720:Csmd1	UTSW	8	15931108	missense	probably damaging	1.00
R7728:Csmd1	UTSW	8	16231271	missense	probably damaging	1.00
R7738:Csmd1	UTSW	8	16100990	missense	probably damaging	1.00
R7745:Csmd1	UTSW	8	15932461	critical splice donor site	probably null
R7879:Csmd1	UTSW	8	16391806	missense	probably benign	0.28
R7884:Csmd1	UTSW	8	15961418	missense	probably damaging	1.00
R7897:Csmd1	UTSW	8	17534919	missense	possibly damaging	0.96
R8111:Csmd1	UTSW	8	15917306	missense	probably benign
R8119:Csmd1	UTSW	8	17027294	missense	probably damaging	0.99
R8134:Csmd1	UTSW	8	15932550	missense	probably damaging	0.99
R8187:Csmd1	UTSW	8	16127174	missense	probably damaging	0.99
R8196:Csmd1	UTSW	8	16009468	missense	probably benign	0.18
R8231:Csmd1	UTSW	8	16697923	missense	possibly damaging	0.82
R8242:Csmd1	UTSW	8	16710654	missense	probably benign	0.42
R8274:Csmd1	UTSW	8	15910453	missense	possibly damaging	0.93
R8286:Csmd1	UTSW	8	15989188	missense	probably benign	0.18
R8289:Csmd1	UTSW	8	16058702	missense	probably damaging	0.99
R8314:Csmd1	UTSW	8	16158244	missense	probably benign
R8323:Csmd1	UTSW	8	17216735	nonsense	probably null
R8387:Csmd1	UTSW	8	16000484	missense	possibly damaging	0.94
R8413:Csmd1	UTSW	8	15900676	missense	probably damaging	0.98
R8672:Csmd1	UTSW	8	15926598	missense	probably benign	0.01
R8765:Csmd1	UTSW	8	16710611	nonsense	probably null
R8789:Csmd1	UTSW	8	17216706	missense	probably damaging	0.99
R8828:Csmd1	UTSW	8	15998794	missense	probably benign	0.00
R8858:Csmd1	UTSW	8	16070304	missense	probably benign	0.10
R8878:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R8911:Csmd1	UTSW	8	16698003	missense	probably damaging	0.99
R8966:Csmd1	UTSW	8	16200045	missense	probably damaging	1.00
R8978:Csmd1	UTSW	8	15921056	missense	probably benign	0.37
R8996:Csmd1	UTSW	8	15921105	missense	possibly damaging	0.54
R9045:Csmd1	UTSW	8	16234074	missense	probably damaging	0.99
R9084:Csmd1	UTSW	8	16088311	missense	probably benign
R9124:Csmd1	UTSW	8	15984806	missense	probably damaging	0.99
R9127:Csmd1	UTSW	8	16223272	missense	probably benign	0.31
R9146:Csmd1	UTSW	8	15998832	missense	probably benign	0.00
R9198:Csmd1	UTSW	8	15912430	missense	probably damaging	1.00
R9285:Csmd1	UTSW	8	15906088	missense	probably damaging	1.00
R9303:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9305:Csmd1	UTSW	8	15961532	missense	probably benign	0.31
R9326:Csmd1	UTSW	8	15999803	missense	probably benign	0.21
R9356:Csmd1	UTSW	8	16202055	missense	probably damaging	1.00
R9385:Csmd1	UTSW	8	15984756	missense	probably benign	0.19
R9444:Csmd1	UTSW	8	16158236	missense	probably benign	0.30
R9476:Csmd1	UTSW	8	15931215	critical splice acceptor site	probably null
R9506:Csmd1	UTSW	8	16200009	missense	probably damaging	1.00
R9614:Csmd1	UTSW	8	16158225	missense	probably benign	0.00
R9668:Csmd1	UTSW	8	16211758	missense	probably benign	0.00
X0011:Csmd1	UTSW	8	16196263	missense	probably damaging	1.00
X0021:Csmd1	UTSW	8	16185256	missense	probably damaging	1.00
X0024:Csmd1	UTSW	8	16037218	missense	probably damaging	0.99
X0028:Csmd1	UTSW	8	15915333	missense	possibly damaging	0.79
Z1088:Csmd1	UTSW	8	15921875	missense	possibly damaging	0.91
Z1088:Csmd1	UTSW	8	16092258	missense	probably damaging	1.00
Z1088:Csmd1	UTSW	8	16189978	missense	possibly damaging	0.50
Z1088:Csmd1	UTSW	8	16200058	missense	probably damaging	0.97
Z1088:Csmd1	UTSW	8	16346617	missense	probably damaging	0.99
Z1176:Csmd1	UTSW	8	15998814	missense	probably damaging	1.00
Z1176:Csmd1	UTSW	8	16037198	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	15984708	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	16200019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGTGCCCAGACAGATCATTG -3'
(R):5'- CACAGTTATTTCCCTGCAAGG -3'

Sequencing Primer
(F):5'- GTGCCCAGACAGATCATTGGTAAAC -3'
(R):5'- CCTGCAAGGGGAAATTTTGAC -3'

Posted On

2018-07-24