Incidental Mutation 'R6736:Sema7a'
ID528435
Institutional Source Beutler Lab
Gene Symbol Sema7a
Ensembl Gene ENSMUSG00000038264
Gene Namesema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
SynonymsCDw108, Semal, 2900057C09Rik, Semaphorin K1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6736 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57940112-57962865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57960571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 477 (V477M)
Ref Sequence ENSEMBL: ENSMUSP00000042211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043059]
Predicted Effect probably damaging
Transcript: ENSMUST00000043059
AA Change: V477M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042211
Gene: ENSMUSG00000038264
AA Change: V477M

DomainStartEndE-ValueType
signal peptide 1 44 N/A INTRINSIC
Sema 72 472 4.11e-119 SMART
PSI 490 540 7.64e-9 SMART
IG 549 630 3.63e-1 SMART
transmembrane domain 644 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of proteins. The encoded preproprotein is proteolytically processed to generate the mature glycosylphosphatidylinositol (GPI)-anchored membrane glycoprotein. The encoded protein is found on activated lymphocytes and erythrocytes and may be involved in immunomodulatory and neuronal processes. The encoded protein carries the John Milton Hagen (JMH) blood group antigens. Mutations in this gene may be associated with reduced bone mineral density (BMD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: The development of the olfactory tract is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,992,268 I83T probably benign Het
Aadacl4 T G 4: 144,623,339 S389A possibly damaging Het
Abca13 A T 11: 9,465,058 S4042C probably damaging Het
Acaca G A 11: 84,238,838 V340I probably benign Het
Acox3 T A 5: 35,588,854 probably null Het
Acsl6 A C 11: 54,325,166 E124A probably damaging Het
Adamtsl1 T A 4: 86,342,247 H898Q probably damaging Het
Agl A G 3: 116,781,680 S603P probably damaging Het
Apobec1 A T 6: 122,581,675 M31K probably null Het
Armc4 C A 18: 7,223,586 V486F probably damaging Het
Astn1 T C 1: 158,511,148 probably null Het
Atp8a1 G T 5: 67,667,617 D790E probably damaging Het
Bahd1 T G 2: 118,915,975 M25R possibly damaging Het
BC034090 A T 1: 155,241,930 N147K possibly damaging Het
Bfsp2 G T 9: 103,480,204 A8E possibly damaging Het
Brwd1 A T 16: 96,068,572 I85N probably damaging Het
Ccdc24 T A 4: 117,870,535 N145I possibly damaging Het
Cdhr5 G T 7: 141,272,531 Q141K probably damaging Het
Cfap46 A G 7: 139,619,971 V1998A possibly damaging Het
Csmd1 T A 8: 16,002,626 Y2166F probably damaging Het
Cul4a T G 8: 13,136,219 S474A probably benign Het
Cutal A G 2: 34,888,137 T112A probably benign Het
Dcaf6 A C 1: 165,399,785 S258A possibly damaging Het
Dek C T 13: 47,099,390 V180M probably damaging Het
Dspp C A 5: 104,178,175 D801E unknown Het
Egflam T C 15: 7,219,725 T871A probably damaging Het
Erbin A T 13: 103,834,766 S781T possibly damaging Het
Erich6 A T 3: 58,625,054 H377Q probably damaging Het
Exo5 C A 4: 120,921,756 G304V probably damaging Het
Eya2 C A 2: 165,716,037 S184R possibly damaging Het
Fhod1 G A 8: 105,337,890 probably benign Het
G6pc3 A G 11: 102,193,670 Y302C possibly damaging Het
Gart T C 16: 91,636,107 D318G probably benign Het
Gm10300 T C 4: 132,074,935 probably benign Het
Gm11937 A G 11: 99,610,074 V39A probably damaging Het
Gm16432 T A 1: 178,017,712 Y99* probably null Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gnas T C 2: 174,334,251 M60T probably damaging Het
Grk5 G T 19: 60,890,626 R16L probably damaging Het
Hcn3 A G 3: 89,152,674 L221P probably damaging Het
Hddc3 G A 7: 80,343,196 R20Q possibly damaging Het
Hectd4 T C 5: 121,277,725 Y530H possibly damaging Het
Igf2bp1 A T 11: 95,973,122 H247Q probably benign Het
Igkv4-70 T A 6: 69,267,928 D103V probably damaging Het
Itpr2 T A 6: 146,325,170 M1359L probably damaging Het
Kalrn A G 16: 34,217,923 L1013S probably damaging Het
Kctd21 C T 7: 97,348,084 R255W probably damaging Het
Krt18 T A 15: 102,030,769 Y263N probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp1 G A 11: 58,042,647 probably null Het
Lmnb1 A G 18: 56,728,469 N144S probably damaging Het
Lrp2 T A 2: 69,448,211 T3933S probably benign Het
Lrrc34 T C 3: 30,624,859 N363S probably benign Het
Lrriq1 T C 10: 103,181,889 probably null Het
Mafa C A 15: 75,747,780 G48V unknown Het
Mboat4 T C 8: 34,124,521 S371P possibly damaging Het
Mei4 A T 9: 82,025,624 M237L probably benign Het
Mfsd2a T C 4: 122,951,261 D219G probably benign Het
Msl2 A G 9: 101,101,002 N192D probably damaging Het
Mycbp2 C A 14: 103,191,567 R2358M probably null Het
Myh10 A G 11: 68,745,339 T185A probably damaging Het
Nipsnap2 T C 5: 129,745,288 probably null Het
Notch1 T C 2: 26,460,286 T2281A probably benign Het
Olfr1165-ps C A 2: 88,101,603 C128F probably benign Het
Olfr1436 G A 19: 12,298,572 Q187* probably null Het
Olfr376 G T 11: 73,375,576 V276F probably benign Het
Olfr533 T C 7: 140,466,887 S229P probably damaging Het
Olfr533 G T 7: 140,466,921 C240F probably damaging Het
Olfr735 A T 14: 50,345,448 N300K probably damaging Het
Olfr895 T A 9: 38,268,570 I19N probably damaging Het
Olfr948 A G 9: 39,318,793 S274P probably damaging Het
Oxct1 T A 15: 4,092,417 S283T probably benign Het
Pcnx2 G T 8: 125,752,317 probably null Het
Piwil4 A G 9: 14,715,823 F424L probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn7 C T 1: 135,139,236 P277L probably benign Het
Rgs12 A G 5: 35,023,092 K27E probably damaging Het
Rp1l1 G T 14: 64,029,724 A920S possibly damaging Het
Rsbn1l A T 5: 20,908,224 H433Q probably benign Het
Safb C A 17: 56,606,023 P913Q possibly damaging Het
Serpina16 T A 12: 103,668,932 T408S possibly damaging Het
Six5 G A 7: 19,094,991 V119M possibly damaging Het
Slc6a16 C T 7: 45,259,028 P11S possibly damaging Het
Smg1 A G 7: 118,157,166 probably benign Het
Sntg1 T A 1: 8,445,050 I420F probably benign Het
Sptb T C 12: 76,613,180 D982G possibly damaging Het
Stag3 T A 5: 138,301,499 F891I probably damaging Het
Sugp1 A G 8: 70,059,303 E183G probably benign Het
Taf1d T C 9: 15,307,823 probably null Het
Tapbp T C 17: 33,919,957 S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 probably benign Het
Ubash3a A G 17: 31,231,415 T355A probably benign Het
Usp16 T G 16: 87,470,397 V225G probably damaging Het
Utrn A G 10: 12,621,303 V2454A probably benign Het
Vmn1r191 G T 13: 22,179,550 F11L probably benign Het
Vmn2r117 A T 17: 23,478,308 C137S probably damaging Het
Zfp143 T C 7: 110,091,814 M524T probably damaging Het
Zfp599 A G 9: 22,249,844 C342R probably damaging Het
Zfp777 T G 6: 48,024,856 K811Q probably damaging Het
Zfp870 T A 17: 32,883,596 H254L probably benign Het
Other mutations in Sema7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Sema7a APN 9 57955838 missense probably damaging 1.00
IGL01967:Sema7a APN 9 57956395 missense probably damaging 1.00
IGL02030:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02031:Sema7a APN 9 57955140 missense possibly damaging 0.91
IGL02115:Sema7a APN 9 57960900 missense probably damaging 1.00
IGL02203:Sema7a APN 9 57957606 missense probably benign
IGL02808:Sema7a APN 9 57960348 missense probably benign 0.25
R0531:Sema7a UTSW 9 57960593 missense possibly damaging 0.95
R1603:Sema7a UTSW 9 57960676 missense probably benign 0.18
R1845:Sema7a UTSW 9 57954899 missense possibly damaging 0.65
R4598:Sema7a UTSW 9 57953551 missense probably benign 0.04
R4903:Sema7a UTSW 9 57955095 missense probably benign 0.00
R4954:Sema7a UTSW 9 57956380 missense probably damaging 1.00
R5172:Sema7a UTSW 9 57957678 missense probably benign 0.02
R5514:Sema7a UTSW 9 57955763 missense probably damaging 1.00
R5618:Sema7a UTSW 9 57960283 missense possibly damaging 0.71
R5652:Sema7a UTSW 9 57960659 missense probably damaging 1.00
R5793:Sema7a UTSW 9 57960257 missense probably damaging 0.98
R6365:Sema7a UTSW 9 57954905 missense probably benign 0.31
R6822:Sema7a UTSW 9 57960336 missense probably damaging 1.00
R6829:Sema7a UTSW 9 57960898 missense probably benign 0.00
R7380:Sema7a UTSW 9 57961564 missense unknown
R7381:Sema7a UTSW 9 57953569 missense probably benign 0.00
R7467:Sema7a UTSW 9 57961422 missense probably damaging 1.00
R7593:Sema7a UTSW 9 57960575 missense probably benign 0.06
R7601:Sema7a UTSW 9 57940277 missense probably benign 0.14
R7879:Sema7a UTSW 9 57955080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTATATCATTGGATGCTGAC -3'
(R):5'- GCATCCCATTCTGAGGTCTG -3'

Sequencing Primer
(F):5'- GGGTGAGCCATCCTACTCTGTAC -3'
(R):5'- GCTTTCCCTTGGGGCCAATG -3'
Posted On2018-07-24