Mutagenetix > Incidental Mutation

Incidental Mutation 'R6736:Abca13'

528441

Institutional Source

Beutler Lab

Gene Symbol

Abca13

Ensembl Gene

ENSMUSG00000004668

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 13

Synonyms

A930002G16Rik

MMRRC Submission

044854-MU

Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9191942-9684259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9465058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 4042 (S4042C)

Ref Sequence

ENSEMBL: ENSMUSP00000040465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042740]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000042740
AA Change: S4042C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: S4042C

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
low complexity region	358	379	N/A	INTRINSIC
low complexity region	441	451	N/A	INTRINSIC
low complexity region	820	831	N/A	INTRINSIC
low complexity region	1382	1393	N/A	INTRINSIC
low complexity region	1721	1737	N/A	INTRINSIC
low complexity region	1859	1872	N/A	INTRINSIC
Pfam:ABC2_membrane_3	3288	3740	4.7e-21	PFAM
low complexity region	3796	3809	N/A	INTRINSIC
AAA	3835	4019	8.08e-12	SMART
transmembrane domain	4206	4228	N/A	INTRINSIC
Pfam:ABC2_membrane_3	4317	4646	1.6e-33	PFAM
AAA	4721	4909	8.86e-9	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,992,268	I83T	probably benign	Het
Aadacl4	T	G	4: 144,623,339	S389A	possibly damaging	Het
Acaca	G	A	11: 84,238,838	V340I	probably benign	Het
Acox3	T	A	5: 35,588,854		probably null	Het
Acsl6	A	C	11: 54,325,166	E124A	probably damaging	Het
Adamtsl1	T	A	4: 86,342,247	H898Q	probably damaging	Het
Agl	A	G	3: 116,781,680	S603P	probably damaging	Het
Apobec1	A	T	6: 122,581,675	M31K	probably null	Het
Armc4	C	A	18: 7,223,586	V486F	probably damaging	Het
Astn1	T	C	1: 158,511,148		probably null	Het
Atp8a1	G	T	5: 67,667,617	D790E	probably damaging	Het
Bahd1	T	G	2: 118,915,975	M25R	possibly damaging	Het
BC034090	A	T	1: 155,241,930	N147K	possibly damaging	Het
Bfsp2	G	T	9: 103,480,204	A8E	possibly damaging	Het
Brwd1	A	T	16: 96,068,572	I85N	probably damaging	Het
Ccdc24	T	A	4: 117,870,535	N145I	possibly damaging	Het
Cdhr5	G	T	7: 141,272,531	Q141K	probably damaging	Het
Cfap46	A	G	7: 139,619,971	V1998A	possibly damaging	Het
Csmd1	T	A	8: 16,002,626	Y2166F	probably damaging	Het
Cul4a	T	G	8: 13,136,219	S474A	probably benign	Het
Cutal	A	G	2: 34,888,137	T112A	probably benign	Het
Dcaf6	A	C	1: 165,399,785	S258A	possibly damaging	Het
Dek	C	T	13: 47,099,390	V180M	probably damaging	Het
Dspp	C	A	5: 104,178,175	D801E	unknown	Het
Egflam	T	C	15: 7,219,725	T871A	probably damaging	Het
Erbin	A	T	13: 103,834,766	S781T	possibly damaging	Het
Erich6	A	T	3: 58,625,054	H377Q	probably damaging	Het
Exo5	C	A	4: 120,921,756	G304V	probably damaging	Het
Eya2	C	A	2: 165,716,037	S184R	possibly damaging	Het
Fhod1	G	A	8: 105,337,890		probably benign	Het
G6pc3	A	G	11: 102,193,670	Y302C	possibly damaging	Het
Gart	T	C	16: 91,636,107	D318G	probably benign	Het
Gm10300	T	C	4: 132,074,935		probably benign	Het
Gm11937	A	G	11: 99,610,074	V39A	probably damaging	Het
Gm16432	T	A	1: 178,017,712	Y99*	probably null	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gnas	T	C	2: 174,334,251	M60T	probably damaging	Het
Grk5	G	T	19: 60,890,626	R16L	probably damaging	Het
Hcn3	A	G	3: 89,152,674	L221P	probably damaging	Het
Hddc3	G	A	7: 80,343,196	R20Q	possibly damaging	Het
Hectd4	T	C	5: 121,277,725	Y530H	possibly damaging	Het
Igf2bp1	A	T	11: 95,973,122	H247Q	probably benign	Het
Igkv4-70	T	A	6: 69,267,928	D103V	probably damaging	Het
Itpr2	T	A	6: 146,325,170	M1359L	probably damaging	Het
Kalrn	A	G	16: 34,217,923	L1013S	probably damaging	Het
Kctd21	C	T	7: 97,348,084	R255W	probably damaging	Het
Krt18	T	A	15: 102,030,769	Y263N	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Larp1	G	A	11: 58,042,647		probably null	Het
Lmnb1	A	G	18: 56,728,469	N144S	probably damaging	Het
Lrp2	T	A	2: 69,448,211	T3933S	probably benign	Het
Lrrc34	T	C	3: 30,624,859	N363S	probably benign	Het
Lrriq1	T	C	10: 103,181,889		probably null	Het
Mafa	C	A	15: 75,747,780	G48V	unknown	Het
Mboat4	T	C	8: 34,124,521	S371P	possibly damaging	Het
Mei4	A	T	9: 82,025,624	M237L	probably benign	Het
Mfsd2a	T	C	4: 122,951,261	D219G	probably benign	Het
Msl2	A	G	9: 101,101,002	N192D	probably damaging	Het
Mycbp2	C	A	14: 103,191,567	R2358M	probably null	Het
Myh10	A	G	11: 68,745,339	T185A	probably damaging	Het
Nipsnap2	T	C	5: 129,745,288		probably null	Het
Notch1	T	C	2: 26,460,286	T2281A	probably benign	Het
Olfr1165-ps	C	A	2: 88,101,603	C128F	probably benign	Het
Olfr1436	G	A	19: 12,298,572	Q187*	probably null	Het
Olfr376	G	T	11: 73,375,576	V276F	probably benign	Het
Olfr533	T	C	7: 140,466,887	S229P	probably damaging	Het
Olfr533	G	T	7: 140,466,921	C240F	probably damaging	Het
Olfr735	A	T	14: 50,345,448	N300K	probably damaging	Het
Olfr895	T	A	9: 38,268,570	I19N	probably damaging	Het
Olfr948	A	G	9: 39,318,793	S274P	probably damaging	Het
Oxct1	T	A	15: 4,092,417	S283T	probably benign	Het
Pcnx2	G	T	8: 125,752,317		probably null	Het
Piwil4	A	G	9: 14,715,823	F424L	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Psmc2	T	A	5: 21,800,576	D218E	probably damaging	Het
Ptpn7	C	T	1: 135,139,236	P277L	probably benign	Het
Rgs12	A	G	5: 35,023,092	K27E	probably damaging	Het
Rp1l1	G	T	14: 64,029,724	A920S	possibly damaging	Het
Rsbn1l	A	T	5: 20,908,224	H433Q	probably benign	Het
Safb	C	A	17: 56,606,023	P913Q	possibly damaging	Het
Sema7a	G	A	9: 57,960,571	V477M	probably damaging	Het
Serpina16	T	A	12: 103,668,932	T408S	possibly damaging	Het
Six5	G	A	7: 19,094,991	V119M	possibly damaging	Het
Slc6a16	C	T	7: 45,259,028	P11S	possibly damaging	Het
Smg1	A	G	7: 118,157,166		probably benign	Het
Sntg1	T	A	1: 8,445,050	I420F	probably benign	Het
Sptb	T	C	12: 76,613,180	D982G	possibly damaging	Het
Stag3	T	A	5: 138,301,499	F891I	probably damaging	Het
Sugp1	A	G	8: 70,059,303	E183G	probably benign	Het
Taf1d	T	C	9: 15,307,823		probably null	Het
Tapbp	T	C	17: 33,919,957	S33P	possibly damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubap2	CT	CTTGCCCCGGT	4: 41,227,224		probably benign	Het
Ubash3a	A	G	17: 31,231,415	T355A	probably benign	Het
Usp16	T	G	16: 87,470,397	V225G	probably damaging	Het
Utrn	A	G	10: 12,621,303	V2454A	probably benign	Het
Vmn1r191	G	T	13: 22,179,550	F11L	probably benign	Het
Vmn2r117	A	T	17: 23,478,308	C137S	probably damaging	Het
Zfp143	T	C	7: 110,091,814	M524T	probably damaging	Het
Zfp599	A	G	9: 22,249,844	C342R	probably damaging	Het
Zfp777	T	G	6: 48,024,856	K811Q	probably damaging	Het
Zfp870	T	A	17: 32,883,596	H254L	probably benign	Het

Other mutations in Abca13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Abca13	APN	11	9297443	missense	probably benign	0.24
IGL00481:Abca13	APN	11	9290969	missense	probably damaging	0.99
IGL00707:Abca13	APN	11	9291586	missense	probably damaging	0.99
IGL00755:Abca13	APN	11	9542102	missense	possibly damaging	0.87
IGL00771:Abca13	APN	11	9290870	missense	probably damaging	1.00
IGL00802:Abca13	APN	11	9297717	missense	probably damaging	0.96
IGL00807:Abca13	APN	11	9378285	missense	probably benign	0.10
IGL00977:Abca13	APN	11	9399284	missense	probably damaging	1.00
IGL01064:Abca13	APN	11	9483855	missense	probably benign	0.01
IGL01100:Abca13	APN	11	9274673	splice site	probably null
IGL01290:Abca13	APN	11	9256232	missense	probably damaging	1.00
IGL01299:Abca13	APN	11	9298743	missense	probably benign	0.22
IGL01302:Abca13	APN	11	9399470	splice site	probably benign
IGL01307:Abca13	APN	11	9297159	missense	possibly damaging	0.86
IGL01349:Abca13	APN	11	9292076	missense	probably benign	0.05
IGL01351:Abca13	APN	11	9267565	missense	probably benign	0.28
IGL01446:Abca13	APN	11	9403834	missense	probably damaging	0.97
IGL01453:Abca13	APN	11	9403834	missense	probably damaging	0.97
IGL01461:Abca13	APN	11	9403834	missense	probably damaging	0.97
IGL01476:Abca13	APN	11	9403834	missense	probably damaging	0.97
IGL01506:Abca13	APN	11	9297447	missense	probably benign	0.36
IGL01527:Abca13	APN	11	9290788	missense	possibly damaging	0.49
IGL01559:Abca13	APN	11	9309020	missense	possibly damaging	0.82
IGL01580:Abca13	APN	11	9293527	missense	probably benign	0.00
IGL01679:Abca13	APN	11	9298071	missense	probably benign	0.07
IGL01731:Abca13	APN	11	9249749	splice site	probably benign
IGL01762:Abca13	APN	11	9315423	missense	probably benign	0.18
IGL01781:Abca13	APN	11	9399280	missense	probably damaging	1.00
IGL01802:Abca13	APN	11	9292438	missense	probably benign	0.00
IGL01809:Abca13	APN	11	9290339	missense	probably damaging	0.96
IGL01906:Abca13	APN	11	9216225	missense	probably damaging	1.00
IGL01928:Abca13	APN	11	9683342	missense	probably benign	0.13
IGL01940:Abca13	APN	11	9567661	splice site	probably benign
IGL01993:Abca13	APN	11	9258452	unclassified	probably benign
IGL02039:Abca13	APN	11	9297193	nonsense	probably null
IGL02159:Abca13	APN	11	9314545	missense	probably benign	0.00
IGL02202:Abca13	APN	11	9288529	missense	possibly damaging	0.55
IGL02268:Abca13	APN	11	9290626	missense	probably benign	0.00
IGL02332:Abca13	APN	11	9291482	missense	probably damaging	0.98
IGL02380:Abca13	APN	11	9291599	missense	possibly damaging	0.73
IGL02466:Abca13	APN	11	9297527	missense	probably benign	0.00
IGL02505:Abca13	APN	11	9581498	missense	probably damaging	1.00
IGL02507:Abca13	APN	11	9399388	missense	probably damaging	1.00
IGL02558:Abca13	APN	11	9399387	missense	probably damaging	1.00
IGL02581:Abca13	APN	11	9399132	splice site	probably benign
IGL02586:Abca13	APN	11	9293983	missense	possibly damaging	0.56
IGL02598:Abca13	APN	11	9431898	missense	probably damaging	1.00
IGL02747:Abca13	APN	11	9373282	nonsense	probably null
IGL02893:Abca13	APN	11	9290543	missense	probably damaging	0.96
IGL02930:Abca13	APN	11	9378226	missense	possibly damaging	0.86
IGL02967:Abca13	APN	11	9378291	missense	probably damaging	0.99
IGL02983:Abca13	APN	11	9290663	missense	probably benign	0.40
IGL02999:Abca13	APN	11	9581757	splice site	probably benign
IGL03100:Abca13	APN	11	9258527	missense	probably benign	0.25
IGL03114:Abca13	APN	11	9528999	missense	probably benign	0.06
IGL03230:Abca13	APN	11	9294313	missense	probably benign	0.02
IGL03329:Abca13	APN	11	9298047	missense	probably benign	0.08
IGL03380:Abca13	APN	11	9298574	missense	probably benign	0.10
IGL02835:Abca13	UTSW	11	9451515	missense	probably damaging	1.00
PIT4366001:Abca13	UTSW	11	9294962	missense	probably benign
PIT4458001:Abca13	UTSW	11	9298304	missense	probably benign	0.05
R0017:Abca13	UTSW	11	9292775	missense	probably damaging	0.99
R0079:Abca13	UTSW	11	9293493	missense	probably benign	0.00
R0089:Abca13	UTSW	11	9292886	missense	possibly damaging	0.76
R0103:Abca13	UTSW	11	9273951	missense	probably damaging	1.00
R0103:Abca13	UTSW	11	9273951	missense	probably damaging	1.00
R0113:Abca13	UTSW	11	9292114	missense	possibly damaging	0.54
R0119:Abca13	UTSW	11	9298076	missense	probably benign	0.03
R0152:Abca13	UTSW	11	9581724	missense	probably damaging	0.98
R0255:Abca13	UTSW	11	9581545	missense	probably damaging	1.00
R0277:Abca13	UTSW	11	9294701	missense	probably benign	0.25
R0278:Abca13	UTSW	11	9378215	missense	probably damaging	1.00
R0294:Abca13	UTSW	11	9269122	splice site	probably null
R0299:Abca13	UTSW	11	9298076	missense	probably benign	0.03
R0310:Abca13	UTSW	11	9293810	missense	probably benign	0.36
R0317:Abca13	UTSW	11	9293459	missense	probably damaging	1.00
R0323:Abca13	UTSW	11	9294701	missense	probably benign	0.25
R0324:Abca13	UTSW	11	9297669	missense	possibly damaging	0.76
R0329:Abca13	UTSW	11	9399430	missense	probably damaging	0.97
R0336:Abca13	UTSW	11	9298481	missense	probably benign	0.04
R0346:Abca13	UTSW	11	9566278	missense	probably damaging	0.99
R0380:Abca13	UTSW	11	9588500	splice site	probably null
R0382:Abca13	UTSW	11	9636650	splice site	probably benign
R0482:Abca13	UTSW	11	9328207	missense	possibly damaging	0.88
R0487:Abca13	UTSW	11	9331687	missense	probably benign	0.07
R0491:Abca13	UTSW	11	9298235	missense	probably benign	0.02
R0496:Abca13	UTSW	11	9291701	missense	probably benign	0.01
R0505:Abca13	UTSW	11	9291058	missense	probably benign	0.00
R0511:Abca13	UTSW	11	9294559	missense	probably benign
R0525:Abca13	UTSW	11	9293371	missense	probably damaging	1.00
R0538:Abca13	UTSW	11	9267622	critical splice donor site	probably null
R0615:Abca13	UTSW	11	9256197	missense	probably damaging	0.96
R0634:Abca13	UTSW	11	9314491	missense	possibly damaging	0.59
R0699:Abca13	UTSW	11	9588508	splice site	probably benign
R0848:Abca13	UTSW	11	9682011	nonsense	probably null
R0883:Abca13	UTSW	11	9291238	nonsense	probably null
R0892:Abca13	UTSW	11	9298305	missense	probably benign	0.00
R0904:Abca13	UTSW	11	9298740	missense	probably benign	0.22
R0968:Abca13	UTSW	11	9298016	missense	probably benign	0.00
R1187:Abca13	UTSW	11	9528981	missense	probably benign	0.00
R1299:Abca13	UTSW	11	9294821	missense	possibly damaging	0.94
R1323:Abca13	UTSW	11	9290937	missense	possibly damaging	0.86
R1323:Abca13	UTSW	11	9290937	missense	possibly damaging	0.86
R1368:Abca13	UTSW	11	9291836	missense	probably benign
R1387:Abca13	UTSW	11	9682085	nonsense	probably null
R1436:Abca13	UTSW	11	9292646	missense	probably damaging	0.99
R1449:Abca13	UTSW	11	9298580	missense	probably damaging	1.00
R1450:Abca13	UTSW	11	9430531	splice site	probably benign
R1462:Abca13	UTSW	11	9483924	splice site	probably benign
R1465:Abca13	UTSW	11	9399303	missense	probably damaging	1.00
R1465:Abca13	UTSW	11	9399303	missense	probably damaging	1.00
R1466:Abca13	UTSW	11	9570536	splice site	probably benign
R1494:Abca13	UTSW	11	9466429	nonsense	probably null
R1559:Abca13	UTSW	11	9399180	missense	probably null	1.00
R1564:Abca13	UTSW	11	9434316	nonsense	probably null
R1698:Abca13	UTSW	11	9314507	missense	probably benign	0.13
R1728:Abca13	UTSW	11	9249680	missense	probably benign	0.02
R1734:Abca13	UTSW	11	9585460	missense	probably benign	0.03
R1781:Abca13	UTSW	11	9269194	missense	probably damaging	1.00
R1782:Abca13	UTSW	11	9297971	missense	probably benign	0.36
R1807:Abca13	UTSW	11	9291755	missense	probably damaging	0.98
R1830:Abca13	UTSW	11	9290350	missense	probably benign	0.04
R1869:Abca13	UTSW	11	9292134	missense	probably benign	0.19
R1870:Abca13	UTSW	11	9292134	missense	probably benign	0.19
R1871:Abca13	UTSW	11	9292134	missense	probably benign	0.19
R1903:Abca13	UTSW	11	9466411	missense	probably benign	0.13
R1916:Abca13	UTSW	11	9534456	missense	probably damaging	1.00
R1936:Abca13	UTSW	11	9293595	missense	probably benign	0.13
R1976:Abca13	UTSW	11	9397815	missense	probably damaging	1.00
R2001:Abca13	UTSW	11	9273967	missense	probably benign	0.01
R2007:Abca13	UTSW	11	9191987	missense	probably benign	0.19
R2016:Abca13	UTSW	11	9290619	missense	probably damaging	1.00
R2017:Abca13	UTSW	11	9290619	missense	probably damaging	1.00
R2034:Abca13	UTSW	11	9292628	missense	possibly damaging	0.83
R2051:Abca13	UTSW	11	9328098	missense	probably benign	0.04
R2075:Abca13	UTSW	11	9522382	missense	probably damaging	1.00
R2118:Abca13	UTSW	11	9309013	splice site	probably benign
R2120:Abca13	UTSW	11	9309013	splice site	probably benign
R2124:Abca13	UTSW	11	9309013	splice site	probably benign
R2148:Abca13	UTSW	11	9615764	missense	probably damaging	1.00
R2149:Abca13	UTSW	11	9267508	missense	possibly damaging	0.68
R2157:Abca13	UTSW	11	9577170	missense	probably damaging	0.97
R2167:Abca13	UTSW	11	9288532	missense	probably benign	0.19
R2261:Abca13	UTSW	11	9292288	missense	probably benign
R2263:Abca13	UTSW	11	9274702	missense	probably benign	0.04
R2281:Abca13	UTSW	11	9328136	missense	probably damaging	0.98
R2340:Abca13	UTSW	11	9399165	missense	probably damaging	0.99
R2357:Abca13	UTSW	11	9297336	missense	probably damaging	1.00
R2370:Abca13	UTSW	11	9256185	missense	possibly damaging	0.85
R2384:Abca13	UTSW	11	9267450	splice site	probably benign
R2393:Abca13	UTSW	11	9275057	nonsense	probably null
R2432:Abca13	UTSW	11	9451333	splice site	probably benign
R2446:Abca13	UTSW	11	9275101	missense	probably benign
R2568:Abca13	UTSW	11	9333310	missense	probably benign	0.40
R2847:Abca13	UTSW	11	9294584	missense	possibly damaging	0.59
R2860:Abca13	UTSW	11	9309057	missense	probably damaging	0.99
R2861:Abca13	UTSW	11	9309057	missense	probably damaging	0.99
R2862:Abca13	UTSW	11	9309057	missense	probably damaging	0.99
R2877:Abca13	UTSW	11	9291889	missense	possibly damaging	0.91
R2878:Abca13	UTSW	11	9291889	missense	possibly damaging	0.91
R3748:Abca13	UTSW	11	9316119	splice site	probably benign
R3789:Abca13	UTSW	11	9510668	missense	probably damaging	0.97
R3933:Abca13	UTSW	11	9354856	missense	probably damaging	1.00
R3981:Abca13	UTSW	11	9532407	missense	probably benign
R4002:Abca13	UTSW	11	9585415	missense	probably benign	0.00
R4010:Abca13	UTSW	11	9622013	splice site	probably benign
R4011:Abca13	UTSW	11	9622013	splice site	probably benign
R4127:Abca13	UTSW	11	9191973	missense	probably benign	0.00
R4214:Abca13	UTSW	11	9293877	missense	probably damaging	0.96
R4236:Abca13	UTSW	11	9256205	missense	probably damaging	1.00
R4237:Abca13	UTSW	11	9434188	missense	probably benign	0.01
R4359:Abca13	UTSW	11	9297629	missense	probably benign	0.02
R4378:Abca13	UTSW	11	9293644	missense	probably benign	0.00
R4389:Abca13	UTSW	11	9297878	missense	probably damaging	0.98
R4392:Abca13	UTSW	11	9309034	missense	possibly damaging	0.94
R4623:Abca13	UTSW	11	9309130	missense	probably damaging	1.00
R4684:Abca13	UTSW	11	9434193	nonsense	probably null
R4691:Abca13	UTSW	11	9434195	missense	probably damaging	1.00
R4700:Abca13	UTSW	11	9292306	missense	possibly damaging	0.59
R4701:Abca13	UTSW	11	9292306	missense	possibly damaging	0.59
R4704:Abca13	UTSW	11	9276990	missense	possibly damaging	0.94
R4751:Abca13	UTSW	11	9277973	critical splice donor site	probably null
R4772:Abca13	UTSW	11	9315339	splice site	probably null
R4782:Abca13	UTSW	11	9328096	missense	probably damaging	0.96
R4801:Abca13	UTSW	11	9522341	missense	possibly damaging	0.94
R4802:Abca13	UTSW	11	9522341	missense	possibly damaging	0.94
R4819:Abca13	UTSW	11	9290421	missense	possibly damaging	0.88
R4831:Abca13	UTSW	11	9542077	nonsense	probably null
R4851:Abca13	UTSW	11	9483890	missense	probably benign	0.02
R4857:Abca13	UTSW	11	9294143	missense	probably benign	0.22
R4869:Abca13	UTSW	11	9315434	splice site	probably null
R4982:Abca13	UTSW	11	9292348	missense	possibly damaging	0.58
R5031:Abca13	UTSW	11	9297678	missense	probably damaging	0.99
R5044:Abca13	UTSW	11	9373323	missense	possibly damaging	0.80
R5092:Abca13	UTSW	11	9258535	missense	probably damaging	1.00
R5155:Abca13	UTSW	11	9532447	missense	probably damaging	0.98
R5173:Abca13	UTSW	11	9682032	frame shift	probably null
R5180:Abca13	UTSW	11	9466510	missense	probably benign	0.01
R5244:Abca13	UTSW	11	9275081	missense	probably benign	0.28
R5257:Abca13	UTSW	11	9249684	missense	possibly damaging	0.94
R5258:Abca13	UTSW	11	9249684	missense	possibly damaging	0.94
R5299:Abca13	UTSW	11	9431861	missense	probably damaging	1.00
R5363:Abca13	UTSW	11	9277035	missense	possibly damaging	0.75
R5365:Abca13	UTSW	11	9628629	missense	probably damaging	1.00
R5419:Abca13	UTSW	11	9193533	critical splice donor site	probably null
R5426:Abca13	UTSW	11	9290722	missense	probably damaging	1.00
R5468:Abca13	UTSW	11	9294062	missense	probably damaging	1.00
R5477:Abca13	UTSW	11	9301298	missense	possibly damaging	0.49
R5541:Abca13	UTSW	11	9291545	missense	probably benign	0.00
R5553:Abca13	UTSW	11	9328158	missense	probably damaging	1.00
R5556:Abca13	UTSW	11	9258546	missense	possibly damaging	0.91
R5566:Abca13	UTSW	11	9294615	nonsense	probably null
R5582:Abca13	UTSW	11	9636639	splice site	probably null
R5604:Abca13	UTSW	11	9566279	missense	probably damaging	0.97
R5609:Abca13	UTSW	11	9403874	missense	probably benign	0.01
R5617:Abca13	UTSW	11	9277891	missense	probably benign	0.00
R5693:Abca13	UTSW	11	9316233	missense	probably benign	0.29
R5707:Abca13	UTSW	11	9510620	missense	probably damaging	1.00
R5725:Abca13	UTSW	11	9577181	missense	probably benign	0.00
R5728:Abca13	UTSW	11	9570576	missense	probably damaging	1.00
R5738:Abca13	UTSW	11	9621917	missense	probably damaging	1.00
R5758:Abca13	UTSW	11	9314536	missense	probably damaging	0.97
R5762:Abca13	UTSW	11	9581665	missense	probably damaging	1.00
R5771:Abca13	UTSW	11	9291411	missense	probably damaging	1.00
R5809:Abca13	UTSW	11	9293692	missense	probably damaging	1.00
R5826:Abca13	UTSW	11	9682056	missense	probably damaging	0.99
R5831:Abca13	UTSW	11	9567777	nonsense	probably null
R5834:Abca13	UTSW	11	9277974	critical splice donor site	probably null
R5902:Abca13	UTSW	11	9297177	missense	probably damaging	1.00
R5933:Abca13	UTSW	11	9249658	missense	possibly damaging	0.63
R5945:Abca13	UTSW	11	9293398	missense	probably benign	0.04
R5969:Abca13	UTSW	11	9292214	nonsense	probably null
R5985:Abca13	UTSW	11	9291628	missense	probably benign	0.02
R5998:Abca13	UTSW	11	9567708	missense	probably damaging	0.97
R6021:Abca13	UTSW	11	9290465	nonsense	probably null
R6022:Abca13	UTSW	11	9290759	missense	probably damaging	1.00
R6032:Abca13	UTSW	11	9297752	missense	possibly damaging	0.52
R6032:Abca13	UTSW	11	9297752	missense	possibly damaging	0.52
R6105:Abca13	UTSW	11	9397812	missense	probably damaging	1.00
R6153:Abca13	UTSW	11	9301259	critical splice acceptor site	probably null
R6162:Abca13	UTSW	11	9309047	missense	probably damaging	1.00
R6187:Abca13	UTSW	11	9309085	missense	probably damaging	1.00
R6247:Abca13	UTSW	11	9403874	missense	probably benign	0.01
R6329:Abca13	UTSW	11	9277937	missense	probably damaging	1.00
R6352:Abca13	UTSW	11	9309139	splice site	probably null
R6367:Abca13	UTSW	11	9216248	missense	possibly damaging	0.85
R6423:Abca13	UTSW	11	9298778	missense	probably benign	0.01
R6424:Abca13	UTSW	11	9510542	missense	probably benign
R6456:Abca13	UTSW	11	9290474	missense	possibly damaging	0.94
R6490:Abca13	UTSW	11	9298661	missense	probably benign	0.00
R6547:Abca13	UTSW	11	9274757	missense	probably benign	0.04
R6594:Abca13	UTSW	11	9294632	missense	possibly damaging	0.52
R6604:Abca13	UTSW	11	9378384	missense	probably damaging	1.00
R6614:Abca13	UTSW	11	9294371	missense	probably benign	0.04
R6742:Abca13	UTSW	11	9328168	missense	probably damaging	1.00
R6791:Abca13	UTSW	11	9378504	missense	probably damaging	1.00
R6834:Abca13	UTSW	11	9275110	missense	possibly damaging	0.48
R6936:Abca13	UTSW	11	9298568	missense	probably damaging	0.96
R6955:Abca13	UTSW	11	9294307	missense	probably benign	0.28
R7031:Abca13	UTSW	11	9621892	missense	probably damaging	1.00
R7065:Abca13	UTSW	11	9292595	missense	probably benign	0.02
R7067:Abca13	UTSW	11	9291845	missense	probably benign	0.14
R7070:Abca13	UTSW	11	9290701	missense	probably benign	0.06
R7094:Abca13	UTSW	11	9298610	missense	probably damaging	0.96
R7102:Abca13	UTSW	11	9335215	missense	probably damaging	1.00
R7105:Abca13	UTSW	11	9397842	missense	probably damaging	1.00
R7131:Abca13	UTSW	11	9291893	missense	probably benign	0.37
R7155:Abca13	UTSW	11	9529010	missense	probably benign
R7158:Abca13	UTSW	11	9273982	missense	probably benign
R7212:Abca13	UTSW	11	9298854	missense	probably benign	0.04
R7215:Abca13	UTSW	11	9288405	splice site	probably null
R7228:Abca13	UTSW	11	9297653	missense	probably benign
R7231:Abca13	UTSW	11	9294175	missense	probably benign	0.25
R7247:Abca13	UTSW	11	9290732	missense	probably benign	0.00
R7278:Abca13	UTSW	11	9291126	missense	possibly damaging	0.56
R7299:Abca13	UTSW	11	9294649	missense	probably damaging	0.98
R7304:Abca13	UTSW	11	9297203	missense	probably benign
R7328:Abca13	UTSW	11	9291545	missense	probably benign	0.14
R7374:Abca13	UTSW	11	9292136	missense	possibly damaging	0.46
R7376:Abca13	UTSW	11	9291118	missense	probably benign	0.00
R7384:Abca13	UTSW	11	9333257	missense	probably damaging	1.00
R7395:Abca13	UTSW	11	9291658	missense	probably benign	0.01
R7419:Abca13	UTSW	11	9276959	missense	probably damaging	1.00
R7419:Abca13	UTSW	11	9297833	missense	probably damaging	1.00
R7421:Abca13	UTSW	11	9510463	missense	probably benign
R7458:Abca13	UTSW	11	9290777	missense	possibly damaging	0.94
R7474:Abca13	UTSW	11	9328088	nonsense	probably null
R7492:Abca13	UTSW	11	9293167	missense	probably benign	0.08
R7660:Abca13	UTSW	11	9290678	missense	probably benign	0.00
R7677:Abca13	UTSW	11	9298349	nonsense	probably null
R7744:Abca13	UTSW	11	9290421	missense	possibly damaging	0.88
R7790:Abca13	UTSW	11	9297915	missense	probably damaging	1.00
R7798:Abca13	UTSW	11	9291664	missense	probably benign	0.04
R7811:Abca13	UTSW	11	9577141	splice site	probably null
R7831:Abca13	UTSW	11	9297404	missense	possibly damaging	0.46
R7867:Abca13	UTSW	11	9262139	critical splice donor site	probably null
R7910:Abca13	UTSW	11	9581590	missense	probably damaging	1.00
R7964:Abca13	UTSW	11	9316146	missense	probably benign	0.06
R8037:Abca13	UTSW	11	9293904	missense	probably damaging	1.00
R8049:Abca13	UTSW	11	9291867	missense	probably damaging	0.99
R8059:Abca13	UTSW	11	9373279	missense	probably benign	0.00
R8072:Abca13	UTSW	11	9294574	missense	probably benign	0.10
R8078:Abca13	UTSW	11	9301279	missense	probably benign	0.32
R8112:Abca13	UTSW	11	9314624	missense	probably benign	0.01
R8146:Abca13	UTSW	11	9397829	missense	probably damaging	1.00
R8164:Abca13	UTSW	11	9615799	missense	probably damaging	1.00
R8195:Abca13	UTSW	11	9274735	missense	probably benign	0.00
R8220:Abca13	UTSW	11	9434299	missense	possibly damaging	0.58
R8235:Abca13	UTSW	11	9262077	missense	probably damaging	0.99
R8307:Abca13	UTSW	11	9277922	nonsense	probably null
R8310:Abca13	UTSW	11	9378269	missense	possibly damaging	0.90
R8315:Abca13	UTSW	11	9378460	missense	probably null	1.00
R8315:Abca13	UTSW	11	9585502	missense	probably benign	0.44
R8324:Abca13	UTSW	11	9290395	missense	probably damaging	1.00
R8375:Abca13	UTSW	11	9315416	missense	probably benign	0.00
R8375:Abca13	UTSW	11	9397841	missense	probably damaging	1.00
R8400:Abca13	UTSW	11	9293925	missense	probably benign	0.00
R8400:Abca13	UTSW	11	9298218	missense	probably damaging	0.97
R8425:Abca13	UTSW	11	9314623	missense	possibly damaging	0.92
R8486:Abca13	UTSW	11	9275092	missense	probably benign	0.00
R8493:Abca13	UTSW	11	9510668	missense	probably damaging	0.97
R8502:Abca13	UTSW	11	9269282	missense	probably benign	0.02
R8716:Abca13	UTSW	11	9293774	missense	probably benign	0.09
R8787:Abca13	UTSW	11	9275053	missense	possibly damaging	0.92
R8829:Abca13	UTSW	11	9621881	missense	probably damaging	1.00
R8859:Abca13	UTSW	11	9378397	missense
R8871:Abca13	UTSW	11	9298071	missense	probably benign	0.07
R8883:Abca13	UTSW	11	9333168	missense	probably benign	0.00
R8919:Abca13	UTSW	11	9291653	missense	possibly damaging	0.84
R8966:Abca13	UTSW	11	9628588	missense	probably damaging	1.00
R8967:Abca13	UTSW	11	9292696	missense	probably benign	0.18
R8969:Abca13	UTSW	11	9277944	missense	probably benign
R8972:Abca13	UTSW	11	9328138	missense	probably damaging	1.00
R9002:Abca13	UTSW	11	9291926	missense	possibly damaging	0.94
R9046:Abca13	UTSW	11	9293525	missense	probably benign	0.04
R9051:Abca13	UTSW	11	9335232	missense	probably damaging	1.00
R9056:Abca13	UTSW	11	9464921	missense	probably damaging	1.00
R9061:Abca13	UTSW	11	9277847	missense	probably benign	0.02
R9072:Abca13	UTSW	11	9290834	missense	possibly damaging	0.93
R9090:Abca13	UTSW	11	9291698	missense	probably damaging	0.98
R9127:Abca13	UTSW	11	9292080	missense	probably benign	0.03
R9164:Abca13	UTSW	11	9328157	missense	probably damaging	1.00
R9175:Abca13	UTSW	11	9581593	missense	probably damaging	0.98
R9190:Abca13	UTSW	11	9291886	missense	probably damaging	0.96
R9244:Abca13	UTSW	11	9291577	missense	probably benign	0.01
R9255:Abca13	UTSW	11	9328213	missense	probably damaging	1.00
R9271:Abca13	UTSW	11	9291698	missense	probably damaging	0.98
R9321:Abca13	UTSW	11	9510475	missense	probably benign	0.00
R9356:Abca13	UTSW	11	9256305	missense	probably benign	0.11
R9369:Abca13	UTSW	11	9378444	missense	probably damaging	1.00
R9423:Abca13	UTSW	11	9290395	missense	probably damaging	1.00
R9432:Abca13	UTSW	11	9294559	missense	probably benign	0.00
R9455:Abca13	UTSW	11	9403897	missense	probably damaging	1.00
R9486:Abca13	UTSW	11	9290621	missense	possibly damaging	0.88
R9492:Abca13	UTSW	11	9293667	nonsense	probably null
R9511:Abca13	UTSW	11	9328130	missense	probably benign	0.16
R9545:Abca13	UTSW	11	9466538	missense	probably damaging	1.00
R9566:Abca13	UTSW	11	9464927	missense	probably damaging	1.00
R9609:Abca13	UTSW	11	9258549	missense	probably damaging	1.00
R9616:Abca13	UTSW	11	9290501	missense	probably benign	0.00
R9651:Abca13	UTSW	11	9293741	missense	probably benign	0.31
R9651:Abca13	UTSW	11	9585484	missense	probably benign
R9653:Abca13	UTSW	11	9293741	missense	probably benign	0.31
R9657:Abca13	UTSW	11	9293379	missense	probably benign	0.35
R9684:Abca13	UTSW	11	9333307	missense	probably damaging	1.00
X0013:Abca13	UTSW	11	9273899	missense	probably benign	0.02
X0057:Abca13	UTSW	11	9294744	missense	probably damaging	0.96
X0066:Abca13	UTSW	11	9267565	missense	probably damaging	0.96
Z1088:Abca13	UTSW	11	9294687	missense	probably damaging	0.99
Z1176:Abca13	UTSW	11	9251376	missense	possibly damaging	0.88
Z1176:Abca13	UTSW	11	9267461	missense	probably damaging	1.00
Z1176:Abca13	UTSW	11	9294342	missense	probably benign	0.01
Z1176:Abca13	UTSW	11	9335181	missense	probably damaging	1.00
Z1176:Abca13	UTSW	11	9335182	missense	probably damaging	1.00
Z1177:Abca13	UTSW	11	9314545	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AATGCTAGCCCAGTCTACCATTC -3'
(R):5'- ATATGCCTCAGTGCTCAGACC -3'

Sequencing Primer
(F):5'- GAAAGGGCCTCTATAATTCTGGCTC -3'
(R):5'- TCAGTGCTCAGACCTGGAAG -3'

Posted On

2018-07-24