Incidental Mutation 'R6736:Erbin'
ID528454
Institutional Source Beutler Lab
Gene Symbol Erbin
Ensembl Gene ENSMUSG00000021709
Gene NameErbb2 interacting protein
Synonyms1700028E05Rik, Erbb2ip, Erbin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6736 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location103818787-103920514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103834766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 781 (S781T)
Ref Sequence ENSEMBL: ENSMUSP00000140536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]
Predicted Effect probably benign
Transcript: ENSMUST00000022222
AA Change: S781T

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1294 1374 3.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000053927
AA Change: S781T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091269
AA Change: S781T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1320 1400 3.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169083
AA Change: S781T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1329 1409 3.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188997
AA Change: S781T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1212 1292 3.6e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191275
AA Change: S781T

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: S781T

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,992,268 I83T probably benign Het
Aadacl4 T G 4: 144,623,339 S389A possibly damaging Het
Abca13 A T 11: 9,465,058 S4042C probably damaging Het
Acaca G A 11: 84,238,838 V340I probably benign Het
Acox3 T A 5: 35,588,854 probably null Het
Acsl6 A C 11: 54,325,166 E124A probably damaging Het
Adamtsl1 T A 4: 86,342,247 H898Q probably damaging Het
Agl A G 3: 116,781,680 S603P probably damaging Het
Apobec1 A T 6: 122,581,675 M31K probably null Het
Armc4 C A 18: 7,223,586 V486F probably damaging Het
Astn1 T C 1: 158,511,148 probably null Het
Atp8a1 G T 5: 67,667,617 D790E probably damaging Het
Bahd1 T G 2: 118,915,975 M25R possibly damaging Het
BC034090 A T 1: 155,241,930 N147K possibly damaging Het
Bfsp2 G T 9: 103,480,204 A8E possibly damaging Het
Brwd1 A T 16: 96,068,572 I85N probably damaging Het
Ccdc24 T A 4: 117,870,535 N145I possibly damaging Het
Cdhr5 G T 7: 141,272,531 Q141K probably damaging Het
Cfap46 A G 7: 139,619,971 V1998A possibly damaging Het
Csmd1 T A 8: 16,002,626 Y2166F probably damaging Het
Cul4a T G 8: 13,136,219 S474A probably benign Het
Cutal A G 2: 34,888,137 T112A probably benign Het
Dcaf6 A C 1: 165,399,785 S258A possibly damaging Het
Dek C T 13: 47,099,390 V180M probably damaging Het
Dspp C A 5: 104,178,175 D801E unknown Het
Egflam T C 15: 7,219,725 T871A probably damaging Het
Erich6 A T 3: 58,625,054 H377Q probably damaging Het
Exo5 C A 4: 120,921,756 G304V probably damaging Het
Eya2 C A 2: 165,716,037 S184R possibly damaging Het
Fhod1 G A 8: 105,337,890 probably benign Het
G6pc3 A G 11: 102,193,670 Y302C possibly damaging Het
Gart T C 16: 91,636,107 D318G probably benign Het
Gm10300 T C 4: 132,074,935 probably benign Het
Gm11937 A G 11: 99,610,074 V39A probably damaging Het
Gm16432 T A 1: 178,017,712 Y99* probably null Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gnas T C 2: 174,334,251 M60T probably damaging Het
Grk5 G T 19: 60,890,626 R16L probably damaging Het
Hcn3 A G 3: 89,152,674 L221P probably damaging Het
Hddc3 G A 7: 80,343,196 R20Q possibly damaging Het
Hectd4 T C 5: 121,277,725 Y530H possibly damaging Het
Igf2bp1 A T 11: 95,973,122 H247Q probably benign Het
Igkv4-70 T A 6: 69,267,928 D103V probably damaging Het
Itpr2 T A 6: 146,325,170 M1359L probably damaging Het
Kalrn A G 16: 34,217,923 L1013S probably damaging Het
Kctd21 C T 7: 97,348,084 R255W probably damaging Het
Krt18 T A 15: 102,030,769 Y263N probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp1 G A 11: 58,042,647 probably null Het
Lmnb1 A G 18: 56,728,469 N144S probably damaging Het
Lrp2 T A 2: 69,448,211 T3933S probably benign Het
Lrrc34 T C 3: 30,624,859 N363S probably benign Het
Lrriq1 T C 10: 103,181,889 probably null Het
Mafa C A 15: 75,747,780 G48V unknown Het
Mboat4 T C 8: 34,124,521 S371P possibly damaging Het
Mei4 A T 9: 82,025,624 M237L probably benign Het
Mfsd2a T C 4: 122,951,261 D219G probably benign Het
Msl2 A G 9: 101,101,002 N192D probably damaging Het
Mycbp2 C A 14: 103,191,567 R2358M probably null Het
Myh10 A G 11: 68,745,339 T185A probably damaging Het
Nipsnap2 T C 5: 129,745,288 probably null Het
Notch1 T C 2: 26,460,286 T2281A probably benign Het
Olfr1165-ps C A 2: 88,101,603 C128F probably benign Het
Olfr1436 G A 19: 12,298,572 Q187* probably null Het
Olfr376 G T 11: 73,375,576 V276F probably benign Het
Olfr533 T C 7: 140,466,887 S229P probably damaging Het
Olfr533 G T 7: 140,466,921 C240F probably damaging Het
Olfr735 A T 14: 50,345,448 N300K probably damaging Het
Olfr895 T A 9: 38,268,570 I19N probably damaging Het
Olfr948 A G 9: 39,318,793 S274P probably damaging Het
Oxct1 T A 15: 4,092,417 S283T probably benign Het
Pcnx2 G T 8: 125,752,317 probably null Het
Piwil4 A G 9: 14,715,823 F424L probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn7 C T 1: 135,139,236 P277L probably benign Het
Rgs12 A G 5: 35,023,092 K27E probably damaging Het
Rp1l1 G T 14: 64,029,724 A920S possibly damaging Het
Rsbn1l A T 5: 20,908,224 H433Q probably benign Het
Safb C A 17: 56,606,023 P913Q possibly damaging Het
Sema7a G A 9: 57,960,571 V477M probably damaging Het
Serpina16 T A 12: 103,668,932 T408S possibly damaging Het
Six5 G A 7: 19,094,991 V119M possibly damaging Het
Slc6a16 C T 7: 45,259,028 P11S possibly damaging Het
Smg1 A G 7: 118,157,166 probably benign Het
Sntg1 T A 1: 8,445,050 I420F probably benign Het
Sptb T C 12: 76,613,180 D982G possibly damaging Het
Stag3 T A 5: 138,301,499 F891I probably damaging Het
Sugp1 A G 8: 70,059,303 E183G probably benign Het
Taf1d T C 9: 15,307,823 probably null Het
Tapbp T C 17: 33,919,957 S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 probably benign Het
Ubash3a A G 17: 31,231,415 T355A probably benign Het
Usp16 T G 16: 87,470,397 V225G probably damaging Het
Utrn A G 10: 12,621,303 V2454A probably benign Het
Vmn1r191 G T 13: 22,179,550 F11L probably benign Het
Vmn2r117 A T 17: 23,478,308 C137S probably damaging Het
Zfp143 T C 7: 110,091,814 M524T probably damaging Het
Zfp599 A G 9: 22,249,844 C342R probably damaging Het
Zfp777 T G 6: 48,024,856 K811Q probably damaging Het
Zfp870 T A 17: 32,883,596 H254L probably benign Het
Other mutations in Erbin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Erbin APN 13 103834012 missense probably damaging 1.00
IGL01404:Erbin APN 13 103839464 missense probably damaging 1.00
IGL01455:Erbin APN 13 103859387 missense probably damaging 1.00
IGL01871:Erbin APN 13 103834766 missense probably damaging 0.98
IGL01930:Erbin APN 13 103841172 missense probably damaging 1.00
IGL02112:Erbin APN 13 103862336 missense probably benign 0.12
IGL02736:Erbin APN 13 103839395 missense probably damaging 1.00
IGL03149:Erbin APN 13 103841163 missense possibly damaging 0.82
IGL03169:Erbin APN 13 103841232 missense possibly damaging 0.93
IGL02802:Erbin UTSW 13 103868130 missense probably damaging 1.00
PIT1430001:Erbin UTSW 13 103859509 missense probably damaging 1.00
R0329:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0330:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0492:Erbin UTSW 13 103834358 missense probably damaging 0.98
R0508:Erbin UTSW 13 103834027 missense probably damaging 1.00
R0589:Erbin UTSW 13 103886287 missense probably damaging 1.00
R1103:Erbin UTSW 13 103886202 missense probably benign 0.00
R1139:Erbin UTSW 13 103884253 missense probably damaging 1.00
R1316:Erbin UTSW 13 103841234 missense possibly damaging 0.94
R1675:Erbin UTSW 13 103841178 missense probably damaging 1.00
R1698:Erbin UTSW 13 103833731 missense possibly damaging 0.91
R1727:Erbin UTSW 13 103827968 missense probably benign 0.01
R1745:Erbin UTSW 13 103839449 missense probably damaging 1.00
R1746:Erbin UTSW 13 103850831 missense probably damaging 1.00
R1764:Erbin UTSW 13 103843451 splice site probably benign
R1828:Erbin UTSW 13 103860069 critical splice donor site probably null
R1840:Erbin UTSW 13 103834947 missense probably benign 0.01
R1987:Erbin UTSW 13 103886203 missense probably benign 0.36
R1992:Erbin UTSW 13 103833713 missense probably benign 0.33
R2013:Erbin UTSW 13 103857533 missense probably damaging 1.00
R2025:Erbin UTSW 13 103830195 missense probably benign 0.01
R2056:Erbin UTSW 13 103830316 missense probably benign 0.27
R2171:Erbin UTSW 13 103834958 missense probably benign 0.00
R2366:Erbin UTSW 13 103844909 missense probably damaging 1.00
R2897:Erbin UTSW 13 103886197 missense probably damaging 1.00
R3912:Erbin UTSW 13 103862287 missense probably benign 0.35
R3912:Erbin UTSW 13 103886338 splice site probably benign
R4073:Erbin UTSW 13 103860111 missense probably damaging 1.00
R4458:Erbin UTSW 13 103833557 missense probably damaging 1.00
R4465:Erbin UTSW 13 103844885 missense probably benign 0.05
R4525:Erbin UTSW 13 103857092 missense probably benign
R4780:Erbin UTSW 13 103884206 missense probably damaging 1.00
R4877:Erbin UTSW 13 103850838 missense probably damaging 0.99
R4879:Erbin UTSW 13 103834774 missense probably benign 0.05
R5396:Erbin UTSW 13 103857409 critical splice donor site probably null
R5898:Erbin UTSW 13 103839305 critical splice donor site probably null
R5955:Erbin UTSW 13 103830192 missense probably benign 0.40
R6073:Erbin UTSW 13 103844921 nonsense probably null
R6107:Erbin UTSW 13 103833892 missense probably benign 0.06
R6257:Erbin UTSW 13 103862288 missense probably benign 0.35
R6294:Erbin UTSW 13 103857056 missense probably benign 0.36
R6358:Erbin UTSW 13 103845565 missense probably damaging 1.00
R6476:Erbin UTSW 13 103841247 missense probably damaging 1.00
R6485:Erbin UTSW 13 103868113 missense probably damaging 1.00
R6631:Erbin UTSW 13 103824892 missense probably benign 0.02
R6735:Erbin UTSW 13 103884210 missense probably damaging 1.00
R6749:Erbin UTSW 13 103834377 missense probably damaging 1.00
R7290:Erbin UTSW 13 103862326 missense probably damaging 1.00
R7767:Erbin UTSW 13 103859399 missense probably damaging 1.00
R8052:Erbin UTSW 13 103834356 nonsense probably null
R8104:Erbin UTSW 13 103834977 missense possibly damaging 0.89
R8140:Erbin UTSW 13 103920294 utr 5 prime probably null
R8303:Erbin UTSW 13 103830186 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGGTTCAACCCTACCAGG -3'
(R):5'- TTCCGGAGCTCCCACAATTC -3'

Sequencing Primer
(F):5'- GTTCAACCCTACCAGGAGACGG -3'
(R):5'- GGAGCTCCCACAATTCTTTTAC -3'
Posted On2018-07-24