Mutagenetix > Incidental Mutation

Incidental Mutation 'R6736:Kalrn'

528463

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

044854-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R6736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34217923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1013 (L1013S)

Ref Sequence

ENSEMBL: ENSMUSP00000110611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: L995S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: L995S

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000089655
AA Change: L1022S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: L1022S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114947
AA Change: L368S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: L368S

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114949
AA Change: L372S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: L372S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: L381S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: L381S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: L381S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: L381S

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114960
AA Change: L1013S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: L1013S

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137216

Predicted Effect

probably damaging
Transcript: ENSMUST00000142817
AA Change: L990S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: L990S

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000151491
AA Change: L769S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: L769S

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 8,992,268	I83T	probably benign	Het
Aadacl4	T	G	4: 144,623,339	S389A	possibly damaging	Het
Abca13	A	T	11: 9,465,058	S4042C	probably damaging	Het
Acaca	G	A	11: 84,238,838	V340I	probably benign	Het
Acox3	T	A	5: 35,588,854		probably null	Het
Acsl6	A	C	11: 54,325,166	E124A	probably damaging	Het
Adamtsl1	T	A	4: 86,342,247	H898Q	probably damaging	Het
Agl	A	G	3: 116,781,680	S603P	probably damaging	Het
Apobec1	A	T	6: 122,581,675	M31K	probably null	Het
Armc4	C	A	18: 7,223,586	V486F	probably damaging	Het
Astn1	T	C	1: 158,511,148		probably null	Het
Atp8a1	G	T	5: 67,667,617	D790E	probably damaging	Het
Bahd1	T	G	2: 118,915,975	M25R	possibly damaging	Het
BC034090	A	T	1: 155,241,930	N147K	possibly damaging	Het
Bfsp2	G	T	9: 103,480,204	A8E	possibly damaging	Het
Brwd1	A	T	16: 96,068,572	I85N	probably damaging	Het
Ccdc24	T	A	4: 117,870,535	N145I	possibly damaging	Het
Cdhr5	G	T	7: 141,272,531	Q141K	probably damaging	Het
Cfap46	A	G	7: 139,619,971	V1998A	possibly damaging	Het
Csmd1	T	A	8: 16,002,626	Y2166F	probably damaging	Het
Cul4a	T	G	8: 13,136,219	S474A	probably benign	Het
Cutal	A	G	2: 34,888,137	T112A	probably benign	Het
Dcaf6	A	C	1: 165,399,785	S258A	possibly damaging	Het
Dek	C	T	13: 47,099,390	V180M	probably damaging	Het
Dspp	C	A	5: 104,178,175	D801E	unknown	Het
Egflam	T	C	15: 7,219,725	T871A	probably damaging	Het
Erbin	A	T	13: 103,834,766	S781T	possibly damaging	Het
Erich6	A	T	3: 58,625,054	H377Q	probably damaging	Het
Exo5	C	A	4: 120,921,756	G304V	probably damaging	Het
Eya2	C	A	2: 165,716,037	S184R	possibly damaging	Het
Fhod1	G	A	8: 105,337,890		probably benign	Het
G6pc3	A	G	11: 102,193,670	Y302C	possibly damaging	Het
Gart	T	C	16: 91,636,107	D318G	probably benign	Het
Gm10300	T	C	4: 132,074,935		probably benign	Het
Gm11937	A	G	11: 99,610,074	V39A	probably damaging	Het
Gm16432	T	A	1: 178,017,712	Y99*	probably null	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gnas	T	C	2: 174,334,251	M60T	probably damaging	Het
Grk5	G	T	19: 60,890,626	R16L	probably damaging	Het
Hcn3	A	G	3: 89,152,674	L221P	probably damaging	Het
Hddc3	G	A	7: 80,343,196	R20Q	possibly damaging	Het
Hectd4	T	C	5: 121,277,725	Y530H	possibly damaging	Het
Igf2bp1	A	T	11: 95,973,122	H247Q	probably benign	Het
Igkv4-70	T	A	6: 69,267,928	D103V	probably damaging	Het
Itpr2	T	A	6: 146,325,170	M1359L	probably damaging	Het
Kctd21	C	T	7: 97,348,084	R255W	probably damaging	Het
Krt18	T	A	15: 102,030,769	Y263N	probably benign	Het
Lamp5	C	G	2: 136,059,563	N102K	possibly damaging	Het
Larp1	G	A	11: 58,042,647		probably null	Het
Lmnb1	A	G	18: 56,728,469	N144S	probably damaging	Het
Lrp2	T	A	2: 69,448,211	T3933S	probably benign	Het
Lrrc34	T	C	3: 30,624,859	N363S	probably benign	Het
Lrriq1	T	C	10: 103,181,889		probably null	Het
Mafa	C	A	15: 75,747,780	G48V	unknown	Het
Mboat4	T	C	8: 34,124,521	S371P	possibly damaging	Het
Mei4	A	T	9: 82,025,624	M237L	probably benign	Het
Mfsd2a	T	C	4: 122,951,261	D219G	probably benign	Het
Msl2	A	G	9: 101,101,002	N192D	probably damaging	Het
Mycbp2	C	A	14: 103,191,567	R2358M	probably null	Het
Myh10	A	G	11: 68,745,339	T185A	probably damaging	Het
Nipsnap2	T	C	5: 129,745,288		probably null	Het
Notch1	T	C	2: 26,460,286	T2281A	probably benign	Het
Olfr1165-ps	C	A	2: 88,101,603	C128F	probably benign	Het
Olfr1436	G	A	19: 12,298,572	Q187*	probably null	Het
Olfr376	G	T	11: 73,375,576	V276F	probably benign	Het
Olfr533	T	C	7: 140,466,887	S229P	probably damaging	Het
Olfr533	G	T	7: 140,466,921	C240F	probably damaging	Het
Olfr735	A	T	14: 50,345,448	N300K	probably damaging	Het
Olfr895	T	A	9: 38,268,570	I19N	probably damaging	Het
Olfr948	A	G	9: 39,318,793	S274P	probably damaging	Het
Oxct1	T	A	15: 4,092,417	S283T	probably benign	Het
Pcnx2	G	T	8: 125,752,317		probably null	Het
Piwil4	A	G	9: 14,715,823	F424L	probably benign	Het
Pkhd1l1	T	C	15: 44,557,940	S3035P	probably damaging	Het
Psmc2	T	A	5: 21,800,576	D218E	probably damaging	Het
Ptpn7	C	T	1: 135,139,236	P277L	probably benign	Het
Rgs12	A	G	5: 35,023,092	K27E	probably damaging	Het
Rp1l1	G	T	14: 64,029,724	A920S	possibly damaging	Het
Rsbn1l	A	T	5: 20,908,224	H433Q	probably benign	Het
Safb	C	A	17: 56,606,023	P913Q	possibly damaging	Het
Sema7a	G	A	9: 57,960,571	V477M	probably damaging	Het
Serpina16	T	A	12: 103,668,932	T408S	possibly damaging	Het
Six5	G	A	7: 19,094,991	V119M	possibly damaging	Het
Slc6a16	C	T	7: 45,259,028	P11S	possibly damaging	Het
Smg1	A	G	7: 118,157,166		probably benign	Het
Sntg1	T	A	1: 8,445,050	I420F	probably benign	Het
Sptb	T	C	12: 76,613,180	D982G	possibly damaging	Het
Stag3	T	A	5: 138,301,499	F891I	probably damaging	Het
Sugp1	A	G	8: 70,059,303	E183G	probably benign	Het
Taf1d	T	C	9: 15,307,823		probably null	Het
Tapbp	T	C	17: 33,919,957	S33P	possibly damaging	Het
Ubap2	GCCCGCTTGCCCCGCT	GCCCGCTTGCCCCGCTTGCCCCGCT	4: 41,227,210		probably benign	Het
Ubap2	CT	CTTGCCCCGGT	4: 41,227,224		probably benign	Het
Ubash3a	A	G	17: 31,231,415	T355A	probably benign	Het
Usp16	T	G	16: 87,470,397	V225G	probably damaging	Het
Utrn	A	G	10: 12,621,303	V2454A	probably benign	Het
Vmn1r191	G	T	13: 22,179,550	F11L	probably benign	Het
Vmn2r117	A	T	17: 23,478,308	C137S	probably damaging	Het
Zfp143	T	C	7: 110,091,814	M524T	probably damaging	Het
Zfp599	A	G	9: 22,249,844	C342R	probably damaging	Het
Zfp777	T	G	6: 48,024,856	K811Q	probably damaging	Het
Zfp870	T	A	17: 32,883,596	H254L	probably benign	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34175722	splice site	probably benign
IGL01364:Kalrn	APN	16	34262629	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34235330	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34294161	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34198512	splice site	probably null
IGL02059:Kalrn	APN	16	34252341	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34220222	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34310527	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34332224	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34360846	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34513959	nonsense	probably null
IGL02696:Kalrn	APN	16	34220114	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34392050	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34220130	nonsense	probably null
IGL03188:Kalrn	APN	16	34314192	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34385297	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34314176	missense	probably damaging	0.99
breeze	UTSW	16	34013675	missense
ethereal	UTSW	16	33975435	utr 3 prime	probably benign
Feather	UTSW	16	34314209	missense	probably damaging	0.99
Hidden	UTSW	16	34027976	missense	probably damaging	1.00
Soulful	UTSW	16	34187484	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34031582	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34198514	splice site	probably benign
R0043:Kalrn	UTSW	16	34054906	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34357171	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34031590	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34049936	intron	probably benign
R0183:Kalrn	UTSW	16	34171379	splice site	probably null
R0422:Kalrn	UTSW	16	34314273	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34054891	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33993670	splice site	probably benign
R0656:Kalrn	UTSW	16	34032467	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34116408	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34010581	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34035554	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34049919	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34385390	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34016498	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33988803	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34212820	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33975754	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34174487	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34314278	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34010548	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34360950	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34212873	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34294215	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34356961	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33975923	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33977524	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34028045	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34189736	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34252310	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34332143	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34332230	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34307724	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34009262	unclassified	probably benign
R2193:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34176262	splice site	probably null
R2404:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34310495	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34212272	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34357315	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34392030	splice site	probably null
R3788:Kalrn	UTSW	16	34220240	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34039889	nonsense	probably null
R3871:Kalrn	UTSW	16	34203856	splice site	probably null
R3934:Kalrn	UTSW	16	34310531	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34235391	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33987208	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34392042	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34235267	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34513926	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34028705	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34176391	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34198487	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34356969	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34514019	unclassified	probably benign
R4888:Kalrn	UTSW	16	34171330	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34357415	splice site	probably null
R5030:Kalrn	UTSW	16	33975742	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34314352	nonsense	probably null
R5117:Kalrn	UTSW	16	34033601	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34252341	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34262653	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34053622	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34175780	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34039934	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34014084	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34016579	missense	probably benign
R5716:Kalrn	UTSW	16	33987176	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33975820	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34212249	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33987091	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33975435	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34243833	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34357343	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34010580	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34360885	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33985191	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34212885	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34357111	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34053639	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34055071	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33975991	missense	probably benign
R6397:Kalrn	UTSW	16	33992985	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34332164	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34205302	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34360984	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34182747	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34027976	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33975703	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34220136	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34357048	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34217891	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34256227	missense	unknown
R7154:Kalrn	UTSW	16	34212157	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34163077	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34176422	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34175761	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34256233	missense	unknown
R7563:Kalrn	UTSW	16	34392094	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34314212	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34031582	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34187484	nonsense	probably null
R7867:Kalrn	UTSW	16	33989791	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33988847	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34028752	missense	probably benign
R8080:Kalrn	UTSW	16	33975668	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34055044	missense	probably benign
R8239:Kalrn	UTSW	16	34049783	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34035061	nonsense	probably null
R8294:Kalrn	UTSW	16	34033584	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34360935	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34034514	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33982855	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34198460	missense	probably benign	0.05
R8878:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R8880:Kalrn	UTSW	16	34217935	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33993655	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34227126	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34034484	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34361001	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34013675	missense
R9424:Kalrn	UTSW	16	33988818	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34095879	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33985230	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34028827	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34212213	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34039933	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34035506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTGGAATCTGAGACCTG -3'
(R):5'- TTCAGCCTTTAGCCATCAGTTG -3'

Sequencing Primer
(F):5'- CTGAGACCTGTGTGACAGTATACAC -3'
(R):5'- CTCCAGTCACAAGGTTCTCAG -3'

Posted On

2018-07-24