Incidental Mutation 'R6736:Vmn2r117'
ID 528468
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788, V2Rp6
MMRRC Submission 044854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6736 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23678649-23698571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23697282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 137 (C137S)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: C137S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: C137S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,211,100 (GRCm39) I83T probably benign Het
Aadacl4 T G 4: 144,349,909 (GRCm39) S389A possibly damaging Het
Abca13 A T 11: 9,415,058 (GRCm39) S4042C probably damaging Het
Acaca G A 11: 84,129,664 (GRCm39) V340I probably benign Het
Acox3 T A 5: 35,746,198 (GRCm39) probably null Het
Acsl6 A C 11: 54,215,992 (GRCm39) E124A probably damaging Het
Adamtsl1 T A 4: 86,260,484 (GRCm39) H898Q probably damaging Het
Agl A G 3: 116,575,329 (GRCm39) S603P probably damaging Het
Apobec1 A T 6: 122,558,634 (GRCm39) M31K probably null Het
Astn1 T C 1: 158,338,718 (GRCm39) probably null Het
Atp8a1 G T 5: 67,824,960 (GRCm39) D790E probably damaging Het
Bahd1 T G 2: 118,746,456 (GRCm39) M25R possibly damaging Het
BC034090 A T 1: 155,117,676 (GRCm39) N147K possibly damaging Het
Bfsp2 G T 9: 103,357,403 (GRCm39) A8E possibly damaging Het
Brwd1 A T 16: 95,869,772 (GRCm39) I85N probably damaging Het
Catspere2 T A 1: 177,845,278 (GRCm39) Y99* probably null Het
Ccdc24 T A 4: 117,727,732 (GRCm39) N145I possibly damaging Het
Cdhr5 G T 7: 140,852,444 (GRCm39) Q141K probably damaging Het
Cfap46 A G 7: 139,199,887 (GRCm39) V1998A possibly damaging Het
Csmd1 T A 8: 16,052,626 (GRCm39) Y2166F probably damaging Het
Cul4a T G 8: 13,186,219 (GRCm39) S474A probably benign Het
Cutal A G 2: 34,778,149 (GRCm39) T112A probably benign Het
Dcaf6 A C 1: 165,227,354 (GRCm39) S258A possibly damaging Het
Dek C T 13: 47,252,866 (GRCm39) V180M probably damaging Het
Dspp C A 5: 104,326,041 (GRCm39) D801E unknown Het
Egflam T C 15: 7,249,206 (GRCm39) T871A probably damaging Het
Erbin A T 13: 103,971,274 (GRCm39) S781T possibly damaging Het
Erich6 A T 3: 58,532,475 (GRCm39) H377Q probably damaging Het
Exo5 C A 4: 120,778,953 (GRCm39) G304V probably damaging Het
Eya2 C A 2: 165,557,957 (GRCm39) S184R possibly damaging Het
Fhod1 G A 8: 106,064,522 (GRCm39) probably benign Het
G6pc3 A G 11: 102,084,496 (GRCm39) Y302C possibly damaging Het
Gart T C 16: 91,432,995 (GRCm39) D318G probably benign Het
Gm10300 T C 4: 131,802,246 (GRCm39) probably benign Het
Gm11937 A G 11: 99,500,900 (GRCm39) V39A probably damaging Het
Gnas T C 2: 174,176,044 (GRCm39) M60T probably damaging Het
Grk5 G T 19: 60,879,064 (GRCm39) R16L probably damaging Het
Hcn3 A G 3: 89,059,981 (GRCm39) L221P probably damaging Het
Hddc3 G A 7: 79,992,944 (GRCm39) R20Q possibly damaging Het
Hectd4 T C 5: 121,415,788 (GRCm39) Y530H possibly damaging Het
Igf2bp1 A T 11: 95,863,948 (GRCm39) H247Q probably benign Het
Igkv4-70 T A 6: 69,244,912 (GRCm39) D103V probably damaging Het
Itpr2 T A 6: 146,226,668 (GRCm39) M1359L probably damaging Het
Kalrn A G 16: 34,038,293 (GRCm39) L1013S probably damaging Het
Kctd21 C T 7: 96,997,291 (GRCm39) R255W probably damaging Het
Krt18 T A 15: 101,939,204 (GRCm39) Y263N probably benign Het
Lamp5 C G 2: 135,901,483 (GRCm39) N102K possibly damaging Het
Larp1 G A 11: 57,933,473 (GRCm39) probably null Het
Lmnb1 A G 18: 56,861,541 (GRCm39) N144S probably damaging Het
Lrp2 T A 2: 69,278,555 (GRCm39) T3933S probably benign Het
Lrrc34 T C 3: 30,679,008 (GRCm39) N363S probably benign Het
Lrriq1 T C 10: 103,017,750 (GRCm39) probably null Het
Mafa C A 15: 75,619,629 (GRCm39) G48V unknown Het
Mboat4 T C 8: 34,591,675 (GRCm39) S371P possibly damaging Het
Mei4 A T 9: 81,907,677 (GRCm39) M237L probably benign Het
Mfsd2a T C 4: 122,845,054 (GRCm39) D219G probably benign Het
Msl2 A G 9: 100,978,201 (GRCm39) N192D probably damaging Het
Mycbp2 C A 14: 103,429,003 (GRCm39) R2358M probably null Het
Myh10 A G 11: 68,636,165 (GRCm39) T185A probably damaging Het
Nipsnap2 T C 5: 129,822,352 (GRCm39) probably null Het
Notch1 T C 2: 26,350,298 (GRCm39) T2281A probably benign Het
Odad2 C A 18: 7,223,586 (GRCm39) V486F probably damaging Het
Or12j4 T C 7: 140,046,800 (GRCm39) S229P probably damaging Het
Or12j4 G T 7: 140,046,834 (GRCm39) C240F probably damaging Het
Or1e1c G T 11: 73,266,402 (GRCm39) V276F probably benign Het
Or4q3 A T 14: 50,582,905 (GRCm39) N300K probably damaging Het
Or5an10 G A 19: 12,275,936 (GRCm39) Q187* probably null Het
Or5d20-ps1 C A 2: 87,931,947 (GRCm39) C128F probably benign Het
Or8c17 T A 9: 38,179,866 (GRCm39) I19N probably damaging Het
Or8g30 A G 9: 39,230,089 (GRCm39) S274P probably damaging Het
Oxct1 T A 15: 4,121,899 (GRCm39) S283T probably benign Het
Pcnx2 G T 8: 126,479,056 (GRCm39) probably null Het
Piwil4 A G 9: 14,627,119 (GRCm39) F424L probably benign Het
Pkhd1l1 T C 15: 44,421,336 (GRCm39) S3035P probably damaging Het
Psmc2 T A 5: 22,005,574 (GRCm39) D218E probably damaging Het
Ptpn7 C T 1: 135,066,974 (GRCm39) P277L probably benign Het
Rgs12 A G 5: 35,180,436 (GRCm39) K27E probably damaging Het
Rp1l1 G T 14: 64,267,173 (GRCm39) A920S possibly damaging Het
Rsbn1l A T 5: 21,113,222 (GRCm39) H433Q probably benign Het
Safb C A 17: 56,913,023 (GRCm39) P913Q possibly damaging Het
Sema7a G A 9: 57,867,854 (GRCm39) V477M probably damaging Het
Serpina16 T A 12: 103,635,191 (GRCm39) T408S possibly damaging Het
Six5 G A 7: 18,828,916 (GRCm39) V119M possibly damaging Het
Slc6a16 C T 7: 44,908,452 (GRCm39) P11S possibly damaging Het
Smg1 A G 7: 117,756,389 (GRCm39) probably benign Het
Sntg1 T A 1: 8,515,274 (GRCm39) I420F probably benign Het
Sptb T C 12: 76,659,954 (GRCm39) D982G possibly damaging Het
Stag3 T A 5: 138,299,761 (GRCm39) F891I probably damaging Het
Sugp1 A G 8: 70,511,953 (GRCm39) E183G probably benign Het
Taf1d T C 9: 15,219,119 (GRCm39) probably null Het
Tapbp T C 17: 34,138,931 (GRCm39) S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 (GRCm39) probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 (GRCm39) probably benign Het
Ubash3a A G 17: 31,450,389 (GRCm39) T355A probably benign Het
Usp16 T G 16: 87,267,285 (GRCm39) V225G probably damaging Het
Utrn A G 10: 12,497,047 (GRCm39) V2454A probably benign Het
Vmn1r191 G T 13: 22,363,720 (GRCm39) F11L probably benign Het
Zfp1002 T A 2: 150,097,198 (GRCm39) Y77F possibly damaging Het
Zfp143 T C 7: 109,691,021 (GRCm39) M524T probably damaging Het
Zfp599 A G 9: 22,161,140 (GRCm39) C342R probably damaging Het
Zfp777 T G 6: 48,001,790 (GRCm39) K811Q probably damaging Het
Zfp870 T A 17: 33,102,570 (GRCm39) H254L probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23,698,520 (GRCm39) missense probably benign
IGL00990:Vmn2r117 APN 17 23,696,814 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23,694,403 (GRCm39) missense probably damaging 1.00
IGL01078:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23,696,778 (GRCm39) missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23,697,356 (GRCm39) missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23,696,215 (GRCm39) missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23,694,356 (GRCm39) missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23,696,199 (GRCm39) missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23,678,758 (GRCm39) missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23,694,552 (GRCm39) splice site probably benign
IGL03167:Vmn2r117 APN 17 23,696,681 (GRCm39) missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23,679,139 (GRCm39) missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23,694,488 (GRCm39) missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23,694,477 (GRCm39) nonsense probably null
R1411:Vmn2r117 UTSW 17 23,679,527 (GRCm39) missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23,697,447 (GRCm39) missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23,696,429 (GRCm39) missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23,697,363 (GRCm39) missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23,696,454 (GRCm39) missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23,696,618 (GRCm39) missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23,679,230 (GRCm39) missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23,678,885 (GRCm39) missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23,678,830 (GRCm39) missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23,679,352 (GRCm39) missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23,679,389 (GRCm39) missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23,679,080 (GRCm39) missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R4560:Vmn2r117 UTSW 17 23,678,851 (GRCm39) missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23,697,390 (GRCm39) missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23,696,859 (GRCm39) missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23,678,812 (GRCm39) missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23,698,487 (GRCm39) frame shift probably null
R5078:Vmn2r117 UTSW 17 23,679,122 (GRCm39) missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23,696,848 (GRCm39) nonsense probably null
R5774:Vmn2r117 UTSW 17 23,696,176 (GRCm39) missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23,698,535 (GRCm39) missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23,679,088 (GRCm39) missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23,679,193 (GRCm39) missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23,679,023 (GRCm39) nonsense probably null
R6909:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23,698,537 (GRCm39) missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23,696,177 (GRCm39) missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23,694,359 (GRCm39) missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23,694,539 (GRCm39) missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23,679,319 (GRCm39) missense probably damaging 1.00
R7443:Vmn2r117 UTSW 17 23,679,107 (GRCm39) missense probably benign 0.25
R7449:Vmn2r117 UTSW 17 23,678,869 (GRCm39) missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23,696,265 (GRCm39) missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23,679,100 (GRCm39) missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23,698,381 (GRCm39) missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23,696,744 (GRCm39) missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23,679,511 (GRCm39) missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23,698,442 (GRCm39) missense probably benign
R8723:Vmn2r117 UTSW 17 23,696,343 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23,679,143 (GRCm39) missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23,679,445 (GRCm39) missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23,678,918 (GRCm39) nonsense probably null
R9244:Vmn2r117 UTSW 17 23,696,589 (GRCm39) missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23,696,578 (GRCm39) missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23,697,450 (GRCm39) missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23,698,479 (GRCm39) missense possibly damaging 0.67
V5622:Vmn2r117 UTSW 17 23,696,814 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r117 UTSW 17 23,678,740 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACTACTTAGATTTGCCCAGG -3'
(R):5'- AAGTATGCTCTGGCTTTGGC -3'

Sequencing Primer
(F):5'- TTAGATTTGCCCAGGCCAAG -3'
(R):5'- CTGGCTTTGGCTTTTTCCATATATG -3'
Posted On 2018-07-24