Incidental Mutation 'R6736:Vmn2r117'
ID 528468
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Name vomeronasal 2, receptor 117
Synonyms EG619788
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6736 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23459675-23479597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23478308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 137 (C137S)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
AlphaFold K7N6V1
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: C137S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: C137S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 8,992,268 I83T probably benign Het
Aadacl4 T G 4: 144,623,339 S389A possibly damaging Het
Abca13 A T 11: 9,465,058 S4042C probably damaging Het
Acaca G A 11: 84,238,838 V340I probably benign Het
Acox3 T A 5: 35,588,854 probably null Het
Acsl6 A C 11: 54,325,166 E124A probably damaging Het
Adamtsl1 T A 4: 86,342,247 H898Q probably damaging Het
Agl A G 3: 116,781,680 S603P probably damaging Het
Apobec1 A T 6: 122,581,675 M31K probably null Het
Armc4 C A 18: 7,223,586 V486F probably damaging Het
Astn1 T C 1: 158,511,148 probably null Het
Atp8a1 G T 5: 67,667,617 D790E probably damaging Het
Bahd1 T G 2: 118,915,975 M25R possibly damaging Het
BC034090 A T 1: 155,241,930 N147K possibly damaging Het
Bfsp2 G T 9: 103,480,204 A8E possibly damaging Het
Brwd1 A T 16: 96,068,572 I85N probably damaging Het
Ccdc24 T A 4: 117,870,535 N145I possibly damaging Het
Cdhr5 G T 7: 141,272,531 Q141K probably damaging Het
Cfap46 A G 7: 139,619,971 V1998A possibly damaging Het
Csmd1 T A 8: 16,002,626 Y2166F probably damaging Het
Cul4a T G 8: 13,136,219 S474A probably benign Het
Cutal A G 2: 34,888,137 T112A probably benign Het
Dcaf6 A C 1: 165,399,785 S258A possibly damaging Het
Dek C T 13: 47,099,390 V180M probably damaging Het
Dspp C A 5: 104,178,175 D801E unknown Het
Egflam T C 15: 7,219,725 T871A probably damaging Het
Erbin A T 13: 103,834,766 S781T possibly damaging Het
Erich6 A T 3: 58,625,054 H377Q probably damaging Het
Exo5 C A 4: 120,921,756 G304V probably damaging Het
Eya2 C A 2: 165,716,037 S184R possibly damaging Het
Fhod1 G A 8: 105,337,890 probably benign Het
G6pc3 A G 11: 102,193,670 Y302C possibly damaging Het
Gart T C 16: 91,636,107 D318G probably benign Het
Gm10300 T C 4: 132,074,935 probably benign Het
Gm11937 A G 11: 99,610,074 V39A probably damaging Het
Gm16432 T A 1: 178,017,712 Y99* probably null Het
Gm21994 T A 2: 150,255,278 Y77F possibly damaging Het
Gnas T C 2: 174,334,251 M60T probably damaging Het
Grk5 G T 19: 60,890,626 R16L probably damaging Het
Hcn3 A G 3: 89,152,674 L221P probably damaging Het
Hddc3 G A 7: 80,343,196 R20Q possibly damaging Het
Hectd4 T C 5: 121,277,725 Y530H possibly damaging Het
Igf2bp1 A T 11: 95,973,122 H247Q probably benign Het
Igkv4-70 T A 6: 69,267,928 D103V probably damaging Het
Itpr2 T A 6: 146,325,170 M1359L probably damaging Het
Kalrn A G 16: 34,217,923 L1013S probably damaging Het
Kctd21 C T 7: 97,348,084 R255W probably damaging Het
Krt18 T A 15: 102,030,769 Y263N probably benign Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Larp1 G A 11: 58,042,647 probably null Het
Lmnb1 A G 18: 56,728,469 N144S probably damaging Het
Lrp2 T A 2: 69,448,211 T3933S probably benign Het
Lrrc34 T C 3: 30,624,859 N363S probably benign Het
Lrriq1 T C 10: 103,181,889 probably null Het
Mafa C A 15: 75,747,780 G48V unknown Het
Mboat4 T C 8: 34,124,521 S371P possibly damaging Het
Mei4 A T 9: 82,025,624 M237L probably benign Het
Mfsd2a T C 4: 122,951,261 D219G probably benign Het
Msl2 A G 9: 101,101,002 N192D probably damaging Het
Mycbp2 C A 14: 103,191,567 R2358M probably null Het
Myh10 A G 11: 68,745,339 T185A probably damaging Het
Nipsnap2 T C 5: 129,745,288 probably null Het
Notch1 T C 2: 26,460,286 T2281A probably benign Het
Olfr1165-ps C A 2: 88,101,603 C128F probably benign Het
Olfr1436 G A 19: 12,298,572 Q187* probably null Het
Olfr376 G T 11: 73,375,576 V276F probably benign Het
Olfr533 T C 7: 140,466,887 S229P probably damaging Het
Olfr533 G T 7: 140,466,921 C240F probably damaging Het
Olfr735 A T 14: 50,345,448 N300K probably damaging Het
Olfr895 T A 9: 38,268,570 I19N probably damaging Het
Olfr948 A G 9: 39,318,793 S274P probably damaging Het
Oxct1 T A 15: 4,092,417 S283T probably benign Het
Pcnx2 G T 8: 125,752,317 probably null Het
Piwil4 A G 9: 14,715,823 F424L probably benign Het
Pkhd1l1 T C 15: 44,557,940 S3035P probably damaging Het
Psmc2 T A 5: 21,800,576 D218E probably damaging Het
Ptpn7 C T 1: 135,139,236 P277L probably benign Het
Rgs12 A G 5: 35,023,092 K27E probably damaging Het
Rp1l1 G T 14: 64,029,724 A920S possibly damaging Het
Rsbn1l A T 5: 20,908,224 H433Q probably benign Het
Safb C A 17: 56,606,023 P913Q possibly damaging Het
Sema7a G A 9: 57,960,571 V477M probably damaging Het
Serpina16 T A 12: 103,668,932 T408S possibly damaging Het
Six5 G A 7: 19,094,991 V119M possibly damaging Het
Slc6a16 C T 7: 45,259,028 P11S possibly damaging Het
Smg1 A G 7: 118,157,166 probably benign Het
Sntg1 T A 1: 8,445,050 I420F probably benign Het
Sptb T C 12: 76,613,180 D982G possibly damaging Het
Stag3 T A 5: 138,301,499 F891I probably damaging Het
Sugp1 A G 8: 70,059,303 E183G probably benign Het
Taf1d T C 9: 15,307,823 probably null Het
Tapbp T C 17: 33,919,957 S33P possibly damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubap2 CT CTTGCCCCGGT 4: 41,227,224 probably benign Het
Ubash3a A G 17: 31,231,415 T355A probably benign Het
Usp16 T G 16: 87,470,397 V225G probably damaging Het
Utrn A G 10: 12,621,303 V2454A probably benign Het
Vmn1r191 G T 13: 22,179,550 F11L probably benign Het
Zfp143 T C 7: 110,091,814 M524T probably damaging Het
Zfp599 A G 9: 22,249,844 C342R probably damaging Het
Zfp777 T G 6: 48,024,856 K811Q probably damaging Het
Zfp870 T A 17: 32,883,596 H254L probably benign Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23459911 missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23460049 nonsense probably null
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23477203 missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23475385 missense probably benign 0.06
R7440:Vmn2r117 UTSW 17 23475565 missense probably benign 0.26
R7443:Vmn2r117 UTSW 17 23460133 missense probably benign 0.25
R7443:Vmn2r117 UTSW 17 23460345 missense probably damaging 1.00
R7449:Vmn2r117 UTSW 17 23459895 missense probably damaging 1.00
R7644:Vmn2r117 UTSW 17 23477291 missense probably damaging 0.98
R7914:Vmn2r117 UTSW 17 23460126 missense possibly damaging 0.95
R8001:Vmn2r117 UTSW 17 23479407 missense possibly damaging 0.89
R8029:Vmn2r117 UTSW 17 23477770 missense probably benign 0.00
R8340:Vmn2r117 UTSW 17 23460537 missense probably benign 0.01
R8519:Vmn2r117 UTSW 17 23479468 missense probably benign
R8723:Vmn2r117 UTSW 17 23477369 missense probably damaging 1.00
R8914:Vmn2r117 UTSW 17 23460169 missense probably benign 0.02
R9010:Vmn2r117 UTSW 17 23460471 missense probably benign 0.10
R9129:Vmn2r117 UTSW 17 23459944 nonsense probably null
R9244:Vmn2r117 UTSW 17 23477615 missense probably damaging 0.98
R9464:Vmn2r117 UTSW 17 23477604 missense probably benign 0.23
R9620:Vmn2r117 UTSW 17 23478476 missense probably damaging 0.97
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Z1176:Vmn2r117 UTSW 17 23459766 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGAACTACTTAGATTTGCCCAGG -3'
(R):5'- AAGTATGCTCTGGCTTTGGC -3'

Sequencing Primer
(F):5'- TTAGATTTGCCCAGGCCAAG -3'
(R):5'- CTGGCTTTGGCTTTTTCCATATATG -3'
Posted On 2018-07-24