Incidental Mutation 'R6694:Nuak2'
ID528478
Institutional Source Beutler Lab
Gene Symbol Nuak2
Ensembl Gene ENSMUSG00000009772
Gene NameNUAK family, SNF1-like kinase, 2
SynonymsSnark, 1200013B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6694 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132316126-132333488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132332310 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 609 (S609A)
Ref Sequence ENSEMBL: ENSMUSP00000080769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072177] [ENSMUST00000082125]
Predicted Effect probably damaging
Transcript: ENSMUST00000072177
AA Change: S617A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072039
Gene: ENSMUSG00000009772
AA Change: S617A

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 315 5.53e-99 SMART
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082125
AA Change: S609A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080769
Gene: ENSMUSG00000009772
AA Change: S609A

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 307 6.1e-106 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133246
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype PHENOTYPE: Most homozygous null mice are exencephalic and die at E16.5 while survivors show a higher number of azoxymethane (AOM)-induced aberrant crypt foci (ACF) in colon. Heterozygotes show increased susceptibility to AOM-induced ACF formation and colon tumors, mature-onset obesity and metabolic disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Lhx4 T C 1: 155,704,710 S257G probably benign Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Nuak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Nuak2 APN 1 132328140 missense probably damaging 1.00
IGL01660:Nuak2 APN 1 132331570 missense probably benign 0.12
IGL02093:Nuak2 APN 1 132332112 missense probably benign
IGL02731:Nuak2 APN 1 132316357 missense probably damaging 1.00
IGL03231:Nuak2 APN 1 132328177 missense probably damaging 1.00
R0547:Nuak2 UTSW 1 132332203 missense probably benign 0.09
R1972:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R1973:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R2897:Nuak2 UTSW 1 132325053 missense probably damaging 1.00
R3420:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3421:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3422:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3890:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3891:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3892:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R4899:Nuak2 UTSW 1 132324986 nonsense probably null
R5068:Nuak2 UTSW 1 132331771 missense probably benign 0.04
R6243:Nuak2 UTSW 1 132332367 missense probably benign 0.01
R6310:Nuak2 UTSW 1 132329961 missense probably damaging 1.00
R6505:Nuak2 UTSW 1 132316394 missense probably damaging 1.00
R6966:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7569:Nuak2 UTSW 1 132316281 missense possibly damaging 0.85
R7708:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7879:Nuak2 UTSW 1 132331957 missense probably benign
R7962:Nuak2 UTSW 1 132331957 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTACCCCTAGCACCTTTGG -3'
(R):5'- CGTAGAGCCCTTGATGTACTC -3'

Sequencing Primer
(F):5'- TTGGCTCCCTGGACCAACTG -3'
(R):5'- GTACTCTATTCACTGGAGGAATCCG -3'
Posted On2018-07-24