Incidental Mutation 'R6694:Lhx4'
ID 528479
Institutional Source Beutler Lab
Gene Symbol Lhx4
Ensembl Gene ENSMUSG00000026468
Gene Name LIM homeobox protein 4
Synonyms Gsh-4, Gsh4, A330062J17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6694 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 155698031-155751684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 155704710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 257 (S257G)
Ref Sequence ENSEMBL: ENSMUSP00000027740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027740] [ENSMUST00000195275]
AlphaFold P53776
PDB Structure The structural basis for partial redundancy in a class of transcription factors, the lim-homeodomain proteins, in neural cell type specification [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027740
AA Change: S257G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027740
Gene: ENSMUSG00000026468
AA Change: S257G

DomainStartEndE-ValueType
LIM 29 80 3.39e-17 SMART
LIM 88 143 2.76e-17 SMART
HOX 157 219 5.79e-23 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195275
AA Change: S196G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141662
Gene: ENSMUSG00000026468
AA Change: S196G

DomainStartEndE-ValueType
LIM 27 82 1.3e-19 SMART
HOX 96 158 2.8e-25 SMART
Meta Mutation Damage Score 0.0701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mutations in this gene result in abnormal lung development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,546 S160N probably benign Het
4930444G20Rik T C 10: 22,067,721 E120G probably damaging Het
Arap3 A C 18: 37,991,537 probably null Het
Arhgap10 A G 8: 77,411,063 F300L probably benign Het
Ccdc116 T C 16: 17,142,791 E54G probably benign Het
Cd53 T A 3: 106,767,386 I122F probably benign Het
Ctnnd1 T C 2: 84,624,505 probably benign Het
Ddx60 A G 8: 62,037,070 D1691G probably damaging Het
Dnah11 T C 12: 118,186,882 probably null Het
Exoc1 T A 5: 76,549,552 M392K probably damaging Het
Exoc3l G C 8: 105,290,490 R622G probably benign Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Kif20a A G 18: 34,625,526 E16G probably damaging Het
Kit T C 5: 75,640,757 V568A possibly damaging Het
Med18 C T 4: 132,459,982 V114I probably benign Het
Mrps30 C T 13: 118,386,961 V92M possibly damaging Het
Mtrr C T 13: 68,564,333 V645I probably benign Het
Nuak2 T G 1: 132,332,310 S609A probably damaging Het
Olfr1393 A T 11: 49,280,552 I135F probably benign Het
Plk4 T C 3: 40,801,828 V58A probably damaging Het
Polq T A 16: 37,015,173 F145L probably null Het
Rab11fip2 T C 19: 59,937,275 K170R probably damaging Het
Rapgef3 A G 15: 97,759,984 V246A probably benign Het
Rc3h2 A G 2: 37,400,543 S316P probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 GCGGCGGC GCGGCGGCGACGGCGGC 7: 97,579,928 probably benign Het
Sae1 G T 7: 16,368,536 A171E probably damaging Het
Setd5 T A 6: 113,143,708 N959K probably benign Het
Siae T A 9: 37,616,823 Y31N probably damaging Het
Sit1 C T 4: 43,483,311 G51D probably damaging Het
Slc5a11 A G 7: 123,267,789 I436V possibly damaging Het
Tcfl5 A G 2: 180,622,654 S470P probably damaging Het
Timd2 A T 11: 46,670,952 C288* probably null Het
Timeless T G 10: 128,239,999 probably null Het
Ubxn8 G T 8: 33,621,544 Q274K possibly damaging Het
Usp29 A G 7: 6,962,277 E373G probably benign Het
Zap70 A G 1: 36,782,517 Y597C probably damaging Het
Zfp523 T G 17: 28,200,472 Y195D probably damaging Het
Zfp74 G A 7: 29,935,134 A383V probably damaging Het
Zfp93 A T 7: 24,275,913 Q441L probably damaging Het
Zfp976 A T 7: 42,614,186 Y76N probably damaging Het
Other mutations in Lhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Lhx4 APN 1 155705188 missense possibly damaging 0.90
IGL02516:Lhx4 APN 1 155702257 missense probably damaging 1.00
IGL02806:Lhx4 APN 1 155702229 missense probably benign 0.22
IGL03104:Lhx4 APN 1 155705221 missense probably damaging 1.00
R3434:Lhx4 UTSW 1 155702401 missense probably damaging 0.99
R3438:Lhx4 UTSW 1 155702484 missense probably benign 0.10
R4369:Lhx4 UTSW 1 155704814 missense probably benign 0.01
R4392:Lhx4 UTSW 1 155710134 missense probably damaging 1.00
R4873:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R4875:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R5937:Lhx4 UTSW 1 155710277 missense probably damaging 1.00
R6329:Lhx4 UTSW 1 155702554 missense probably benign 0.00
R7212:Lhx4 UTSW 1 155724953 missense probably benign 0.01
R7418:Lhx4 UTSW 1 155710259 missense probably damaging 1.00
R7653:Lhx4 UTSW 1 155704871 missense probably damaging 1.00
R7900:Lhx4 UTSW 1 155741963 intron probably benign
R8210:Lhx4 UTSW 1 155710468 splice site probably null
R8510:Lhx4 UTSW 1 155702301 missense probably damaging 1.00
R8889:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R8892:Lhx4 UTSW 1 155705267 missense possibly damaging 0.90
R9300:Lhx4 UTSW 1 155705210 missense probably damaging 1.00
R9322:Lhx4 UTSW 1 155702607 missense probably benign 0.00
R9532:Lhx4 UTSW 1 155710278 missense probably damaging 1.00
Z1176:Lhx4 UTSW 1 155705255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTATCCCAGCAACTGTTC -3'
(R):5'- TAGGTAACCCCTGAATGTTTCC -3'

Sequencing Primer
(F):5'- GTATCCCAGCAACTGTTCTCTTG -3'
(R):5'- GGTAACCCCTGAATGTTTCCTCTTTG -3'
Posted On 2018-07-24